Abstract

Myocardial infarction (MI) is the leading cause of mortality worldwide. Interleukin (IL)-33 (IL-33) is a cytokine present in most cardiac cells and is secreted on necrosis where it acts as a functional ligand for the ST2 receptor. Although IL-33/ST2 axis is protective against various forms of cardiovascular diseases, some studies suggest potential detrimental roles for IL-33 signaling. The aim of the present study was to examine the effect of IL-33 administration on cardiac function post-MI in mice. MI was induced by coronary artery ligation. Mice were treated with IL-33 (1 μg/day) or vehicle for 4 and 7 days. Functional and molecular changes of the left ventricle (LV) were assessed. Single cell suspensions were obtained from bone marrow, heart, spleen, and peripheral blood to assess the immune cells using flow cytometry at 1, 3, and 7 days post-MI in IL-33 or vehicle-treated animals. The results of the present study suggest that IL-33 is effective in activating a type 2 cytokine milieu in the damaged heart, consistent with reduced early inflammatory and pro-fibrotic response. However, IL-33 administration was associated with worsened cardiac function and adverse cardiac remodeling in the MI mouse model. IL-33 administration increased infarct size, LV hypertrophy, cardiomyocyte death, and overall mortality rate due to cardiac rupture. Moreover, IL-33-treated MI mice displayed a significant myocardial eosinophil infiltration at 7 days post-MI when compared with vehicle-treated MI mice. The present study reveals that although IL-33 administration is associated with a reparative phenotype following MI, it worsens cardiac remodeling and promotes heart failure.

Introduction

Cardiovascular diseases, primarily acute myocardial infarction (MI) and stroke, represent the leading cause of mortality in the Western world and are on the rise in developing countries. Despite improved outcomes due to advances in medical and interventional treatments, a considerable number of MI patients still develop progressive left ventricular dysfunction [1]. The healing process post-MI implicates a variety of cellular and molecular mechanisms that induce the replacement of necrotic myocardial tissue with a collagen-based scar [2,3]. Understanding the progression and resolution of the inflammatory processes occurring following an MI may reveal new strategies aimed at preserving cardiac function and preventing ischemic cardiomyopathy, therefore complementing available neurohumoral blockade and interventional approaches.

Interleukin (IL)-33 (IL-33) is a constitutively expressed cytokine belonging to the IL-1 family, known to activate innate and adaptive immunities [4]. Following tissue injury, IL-33 is released as an alarmin from damaged cells, and plays a role in the activation of immune cells and in promoting tissue repair [5,6]. The two known receptor isoforms for IL-33 are the long ST2 (ST2L) and the soluble ST2 (sST2) [7–9]. The long or transmembrane isoform (ST2L) is expressed on a variety of immune cells and is responsible for IL-33 signaling effects [10–16]. sST2, however, acts as a decoy receptor thereby preventing IL-33 signaling [17]. sST2 has gained much attention as a cardiovascular biomarker mainly predicting congestive heart failure and decreased survival in patients with acute MI [8,18–20].

IL-33 has been associated with a number of inflammatory, immune, and allergic disorders including arthritis, atherosclerosis, inflammatory bowel disease, obesity, and asthma [21]. IL-33 is also implicated in the activation of type 2 innate lymphoid cells (ILC2), which are a member of the newly discovered innate lymphoid cell (ILC) family and are involved in tissue remodeling and lipid metabolism in adipose tissues [14,22–24]. Following their activation, ILC2 produce type 2 cytokines such as IL-5 and IL-13 [25–27], which participate in eosinophil homeostasis, recruitment, and proliferation [25,28]. ILC2 are found in the heart during inflammation settings such as myocardial ischemia and eosinophilic pericarditis [29,30].

In the heart, IL-33 is released from cardiomyocytes, coronary artery smooth muscle cells, and cardiac fibroblasts [4,20,29]. IL-33 is reported to have protective effects on cardiac function in many cardiovascular settings including cardiac overload [31,32], abdominal aortic aneurysm [33] and atherosclerosis [34,35], as well as MI, and is portrayed as a potential novel therapeutic cytokine [36–38]. However, a study performed on atherosclerotic-prone apolipoprotein E (ApoE)-deficient mice reported that the IL-33/ST2 pathway is not implicated in this pathophysiology [39]. Another, recent study involving patients with end-stage heart failure showed that the expression of the IL-33/ST2 pathway in the failing human heart is associated with increased pro-fibrotic signaling proteins and overall cardiac fibrosis, suggesting a role of this pathway in pro-fibrotic myocardial remodeling [40]. Moreover, an exogenous administration of IL-33 has been shown to promote eosinophilic pericarditis and adversely affect heart function even in healthy mice [41]. The aim of the present study was to assess the impact of IL-33 on the myocardial pathological changes, including ventricular remodeling, myocardial dysfunction, fibrosis, immune cell infiltration, and survival following MI.

Materials and methods

Experimental design

Animals were housed in sterilized cages and maintained on a 12-h (light:dark) cycle with access to autoclaved rodent chow and water ad libitum. Operating procedures were performed in the animal care facility of the American University of Beirut Medical Center (AUBMC). All experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee of the AUB (IACUC # 18-2-RN560). Adult wild-type (WT) male C57/BL6J mice (12–14 weeks of age) were randomized into four different groups: sham+vehicle, sham+IL-33, MI+vehicle, and MI+IL33. In the sham and MI groups treated with IL-33, a single daily injection of mouse recombinant IL-33 (BioLegend, San Diego, CA, U.S.A.) (1 μg suspended in 200 μl PBS) was administered intraperitoneally (i.p.) right after sham operation or left anterior descending (LAD) ligation (starting day 0) and continued for 4 or 7 days thereafter. IL-33 dose and route of administration were based on previous studies [36,37]. In the sham and MI groups treated with vehicle, a single daily injection of PBS (200 μl/day) was i.p. administered right after sham operation or LAD ligation (starting day 0) and continued for 4 or 7 days thereafter. For flow cytometric analyses, mice were given a single (i.p.) daily injection of IL-33 or its vehicle right after sham-operation or LAD ligation (day 0) and continued for 1, 3, or 7 days thereafter.

Induction of MI

Mice were subjected to a permanent ligation (MI group) (n=167) or no ligation (sham group) (n=58) of the LAD coronary artery as previously described [42]. In brief, mice were first administered a dose of 0.05 mg/kg buprenorphine (Reckitt Benckiser Pharmaceuticals, Richmond, VA) for pre-emptive and post-operative analgesia. Mice were then anesthetized with 2% isoflurane, intubated orotracheally, and ventilated with a MiniVent ventilator (type 845) (HSE Harvard, Germany). After shaving the chest wall, a small thoracotomy was performed between the left third and fourth intercostal space. The pericardial sac was cut open, the left ventricle (LV) visualized and the LAD isolated with a 7-0 prolene suture (Ethicon, Norderstdedt, Germany), 2 mm below the left atrioventricular border. Successful ligation was confirmed by visual discoloration of the ventricle distal to the occlusion site and confirmed by ST elevation on ECG using Indus MouseMonitor® system. The same procedure was performed for sham-operated mice, but without LAD ligation. Ribs, muscles, and skin were closed in layers using 6-0 prolene sutures (Ethicon, Norderstdedt, Germany). The mouse was then weaned from isoflurane anesthesia, flushed with oxygen, extubated, and allowed to warm under an infrared lamp until full consciousness.

Echocardiography

To evaluate the progression of cardiac function or dysfunction, serial echocardiographic measurements were performed at baseline, day 1 post-surgery (LAD ligation or sham operation), and on the day of killing (4 or 7 days). All measurements and assessments were performed using the Visual Sonics Echo system (Vevo 2100, VisualSonics, Inc., Toronto, Canada) and the 22–55 MHz (MS550D) linear transducer (VisualSonics). Mortality rate was recorded for the entire study period. Mice were placed in the echocardiography room for at least 30 min before the examination. Mice were maintained unconscious using 2% isoflurane and placed in a supine position on a heating platform. The chest was shaved and ultrasonic gel was applied to the thoracic area to allow maximal visibility of the heart chambers. The ultrasonic probe was placed on the chest along the long-axis of the LV and adjusted to obtain clear two-dimensional B-mode and M-mode parasternal long axis images. Five minutes were allowed for each animal to stabilize in that position and before acquiring any measurement. Heart rate was maintained constant throughout the procedure (450–550 beats/min). For each parameter, three consecutive cardiac cycles were analyzed and averaged.

Necropsy and tissue harvest

Mice were administered 100 μl Heparin (Heparin Sodium 1000 I.U./ml) 30 min prior to killing. Following deep anesthesia with 4% isoflurane, blood was collected by cardiac puncture, centrifuged at 2200 rpm for 10 min, and the plasma flash-frozen in liquid nitrogen and stored at −80°C for future use. Mice were then subjected to cervical dislocation. Hearts were immediately injected with cardioplegic solution to arrest the LV chamber in diastole. After excision, hearts were rinsed with physiological saline, weighed, and the left and right atria were resected along with the large vessels. The mid-section was then kept in 4% formalin, and the base and apex were snap-frozen in liquid nitrogen and stored at −80°C for further experiments. Lungs were collected, weighed, and placed in a 37°C oven overnight to assess pulmonary congestion (Lungs Wet − Lungs Dry) × 100/Lungs Wet). Spleens were collected, weighed, and stored in liquid nitrogen. Tibia length was also measured and used for normalization. For FACS tissue harvesting, single cell suspensions were obtained from mouse peripheral blood, bone marrow, spleen, and heart. Briefly, mice were given 100 μl of Heparin (1000 I.U./ml) 30 min prior to necropsy. Mice were then subjected to isoflurane anesthesia, blood was collected by cardiac puncture, and hearts perfused through the LV with 5 ml of ice-cold PBS. Hearts and spleens were excised and placed in ice cold PBS (1% FBS) (FACS buffer). Femurs and tibias were also harvested, cleaned of all connective tissue, and bone marrow was then collected by flushing through the bones with ice-cold FACS buffer. Heart specimens were cut in fragments of 2–3 mm3. Fragments were suspended in 5-ml DMEM (10% FBS) containing an enzymatic cocktail (Collagenase D (450 U/ml), Roche/Sigma, cat# 11088858001; Dispase (1 U/ml), STEMCELL Technologies, cat# 07923; and DNAse I grade II (60 U/ml), Roche/Sigma, cat# 10104159001) and mechanically dissociated using the Miltenyi GentleMACS for 15 s. Dissociated tissue was digested for 30 min at 37°C with gentle rotation. Whole blood was first subjected to immunofluorescence staining, then lysed using the red blood cell lysis buffer (Qiagen, cat# 158904). Spleens, bone marrow suspensions, and digested heart tissue were then triturated, and cells filtered through a 40-μm nylon mesh (BD Falcon). Cell suspensions were centrifuged (400×g, 4°C for 10 min) and subjected to red blood cell lysis for 3 min. The lysis reaction was stopped using 20 ml FACS buffer and the mix was centrifuged (400×g, 4°C for 5 min). Total leukocyte numbers were determined using Trypan Blue. For each panel, 100 μl of cell suspension containing 1 × 106 cells was used from each organ.

Determination of infarct size

The LV was separated from the right, and sliced transversally into three sections (1–2 mm in thickness): apex, mid-section, and base. Sections, including the right ventricle, were incubated with 2% of 2,3,5 triphenyltetrazolium chloride (TTC) for 10 min at 37°C in the dark. Sections were photographed with a high-resolution digital camera (EOS rebelT3i DSLR, Canon, Tokyo, Japan). Infarct scar area, defined as regions unstained by TTC, were quantified using ImageJ 1.52 software and calculated as the ratio of infarct area to total LV area. All measurements were performed by an investigator who was blinded to the identity of the animals.

Survival

Starting with recovery from surgery, survival rate was assessed based on the animals that survived until the day of killing. An autopsy was performed on each animal found dead. Mortality was assessed using Kaplan–Meier survival curve analysis.

Histology

Formalin-fixed heart mid-sections were embedded in paraffin blocks, cut into transverse 5-μm sections and placed on microscope slides. After dewaxing and hydration steps using xylene and ethanol (100, 95, 70%), sections were stained with Hematoxylin and Eosin (H&E) and Masson’s Trichrome (MTC) to assess cardiomyocyte hypertrophy and areas of myocardial fibrosis, respectively. Imaging was performed on an Olympus CX41 microscope, and quantification was assessed in a blinded fashion using ImageJ 1.52 software. A minimum of ten fields per section and three to four animals were analyzed per experimental group. The area of myocardial fibrosis was quantitatively measured from the photomicrographs of MTC stained slides by ImageJ 1.52 software. The fibrosis was identified using the differences in color (blue fibrotic area opposed to red myocardium) of MTC-stained slides. The results are presented as the ratio of fibrotic area to the whole area of the myocardium using 10× magnification. For cardiomyocyte hypertrophy, a 20× objective was used, and digital images taken from the subendocardial and subepicardial regions of the LV wall were analyzed. The cross-sectional area (CSA) of individual cardiomyocytes was measured by tracing boundaries of each cardiomyocyte on each image. CSAs were defined from an average of 100 cardiomyocytes per mouse.

Western blot analysis

Mouse tissues were ground with liquid nitrogen and proteins were extracted in RIPA buffer containing protease inhibitors (Roche, Basel, Switzerland), and quantified using Thermo Scientific NanoDrop 1000 UV-Vis spectrophotometer (Thermo Scientific, Waltham, MA) according to the manufacturer’s recommended protocol. Concentrations were estimated based on an average obtained from triplicate measurements of the same sample. The Lowry colorimetric assay and Nanodrop 1000 methods were previously compared in our lab and both gave the same range of protein quantification. An equal amount of protein (100 μg) from each sample was heated at 95°C for 10 min and electrophoresed under reducing conditions on a 15% SDS polyacrylamide gel and transferred on to a nitrocellulose membrane. Membranes were blocked with 5% nonfat milk 1 h at room temperature, and incubated with the primary antibody against transforming growth factor β (TGF-β) (1/500, cat# ab92486, Abcam); α smooth muscle actin (α-SMA) (1/200, Abcam, cat# ab5694); IL-1β (1/500, Abcam, cat# ab9722); tumor necrosis factor-α (TNF-α) (1:1000, Cell Signaling Technology, cat# 11948); and IL-4 (1/1000, Abcam, cat# ab9728); IL-10 (1/1000; Abcam, cat#ab9969) and IL-13 (1/500; Abcam; cat#ab106732) overnight on a rocker at 4°C. After four washes with Tris-buffered saline-Tween (TBST) (0.02%), membranes were incubated for 1 h with species-appropriate peroxidase-conjugated secondary antibody (1/40000) at room temperature. Finally, membranes were washed twice with TBST (0.02%) and TBS, and immunoreactive bands were then visualized with enhanced chemiluminescence (Clarity Western ECL substrate, Bio-Rad) to detect protein bands using the ChemiDoc MP imaging system. Due to the instability of housekeeping proteins such as β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and β-tubulin in animals models of myocardial ischemic infarction [43], total protein levels were used as loading controls. The band densities of each protein of interest were normalized to the density of the total protein bands appearing in the same lane and on the same membrane. All data were then calibrated as fold change to the average of sham-operated vehicle-treated group. Western blot bands and total protein representative figures are shown in (Supplementary Figure S4).

Ribonucleic acid extraction and reverse transcription quantitative polymerase chain reaction

Total ribonucleic acid (RNA) was isolated from whole mouse heart using TRIzol isolation reagent. Reverse transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen), and reverse transcription quantitative polymerase chain reaction (RT-qPCR) was completed using the QuantiFast SYBR Green PCR Kit (Qiagen) according to the manufacturer’s instructions. Real-Time PCR was performed on a CFX-96 RT-PCR system (Bio-Rad). Cycle quantification (Cq) values were assessed during the exponential amplification phase. The quantified data were analyzed using the 2−ΔΔCt method and the relative expression levels of target genes, defined as fold change, and were normalized to the corresponding fold change of the sham+vehicle group, which was defined as 1.0. The primers used for RT-qPCR are listed in Table 1. mRNA levels were standardized with the housekeeping gene hypoxanthine-phosphoribosyl transferase (HPRT), and all experiments were performed using n=3 for sham+vehicle and n=5 or 6 for all other groups.

Table 1
Primers used for RT-PCR analysis
MousemRNA forward primer (5′–3′)Reverse primer (5′–3′)
HPRT GTTGGGCTTACCTCACTGCT TAATCACGACGCTGGGACTG 
sST2 ACGCTCGACTTATCCTGTGG CAGGTCAATTGTTGGACACG 
BAX ATCCAAGACCAGGGTGGCT CCTTCCCCCATTCATCCCAG 
BCL2 AGTACCTGAACCGGCATCTG TATGCACCCAGAGTGATGCAG 
IL-5 ATGAGGCTTCCTGTCCCTACT TACCCCCACGGACAGTTTGA 
MMP2 AGATGCAGAAGTTCTTTGGGCTGC AGTTGTAGTTGGCCACATCTGGGT 
MMP9 ACCACAGCCAACTATGACCAGGAT AAGAGTACTGCTTGCCCAGGAAGA 
CTGF ACCCAACTATGATGCGAGCC GGTAACTCGGGTGGAGATGC 
MousemRNA forward primer (5′–3′)Reverse primer (5′–3′)
HPRT GTTGGGCTTACCTCACTGCT TAATCACGACGCTGGGACTG 
sST2 ACGCTCGACTTATCCTGTGG CAGGTCAATTGTTGGACACG 
BAX ATCCAAGACCAGGGTGGCT CCTTCCCCCATTCATCCCAG 
BCL2 AGTACCTGAACCGGCATCTG TATGCACCCAGAGTGATGCAG 
IL-5 ATGAGGCTTCCTGTCCCTACT TACCCCCACGGACAGTTTGA 
MMP2 AGATGCAGAAGTTCTTTGGGCTGC AGTTGTAGTTGGCCACATCTGGGT 
MMP9 ACCACAGCCAACTATGACCAGGAT AAGAGTACTGCTTGCCCAGGAAGA 
CTGF ACCCAACTATGATGCGAGCC GGTAACTCGGGTGGAGATGC 

Assessment of cytokine levels by enzyme-linked immunosorbent assay

The concentrations of IL-5 (Stem Cell Technologies, cat# 02024); granulocyte macrophage-colony stimulating factor (GM-CSF, Invitrogen, cat# BMS612); and IL-33 (Abcam, cat# ab213475) were determined in mouse plasma using enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer’s instructions. All samples were analyzed in duplicates.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling assay

Myocardial tissue sections obtained from sham-operated and LAD-ligated mice (treated with IL-33 or its vehicle (PBS)) at two different time points (4 and 7 days) were analyzed. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining was performed on 5-μm-thick paraffin-embedded heart sections. Tissue sections were deparaffinized and rehydrated, then cardiomyocyte DNA fragmentation was evaluated using the Click-iT Plus TUNEL Assay for In Situ Apoptosis Detection (Thermo Fisher). The operation was performed according to the protocol provided by the manufacturer. Images were captured by the Zeiss Axio light microscope. Apoptotic nuclei were stained red with Alexa Fluor 647 and counterstained with DAPI (4,6-diamino-2phenylindole (blue)) to count the total number of normal nuclei per field. The total number of both TUNEL-positive myocytes and normal cardiomyocyte nuclei was counted using ImageJ (version 1.52) software.

Single cell suspension and flow cytometry

Mice were killed on days 1, 3, and 7 post-MI. A subset of five to six mice for the MI group and three to four mice for the sham-operated group per time point was used for flow cytometric analysis. Immunofluorescence staining was performed on single cell suspensions obtained from mouse peripheral blood, bone marrow, spleen, and heart as previously described [29,44]. Immune cell populations were defined based on previously published data [45,46]. For each panel, 100 μl of cell suspension was used from each organ and stained with 50 μl of the antibody mix. Each panel was used in the presence of 0.5 μg blocking antibody, anti-CD16/CD32 (clone 2.4G2, BD Pharmingen). Dead cells were excluded by the use of a viability dye (DAPI, Thermo Fisher). Samples were acquired on a BD FACS ARIA SORP cell sorter flow cytometer (BD Bioscience) and the raw data analyzed using FlowJo software (v10.5.3, Tree Star). All antibodies were purchased from Biolegend, eBioscience, or BD Biosciences. Data were analyzed on cells within the live gate and reported as percentage of cell number in CD45+ cells (neutrophils and eosinophils) and as percentage of cell number in live cells (classical monocytes, macrophages, and ILC2). Flow cytometry panels showing antibodies and their corresponding fluorochromes are summarized in Table 2. Representative pseudocolor flow cytometric gatings of the population subsets are shown in (Supplementary Figures S5–S8).

Table 2
Flow cytometry panels showing antibodies and their corresponding fluorochromes and the targeted cell populations
Panel numberAntibodiesPopulations
CD11b-efluor450 (M1/70), Ly6C-FITC (AL21), F480-APC (BM8), Ly6G-PE (1A8) • Classical monocytes (CD11b+Ly6C(hi)Ly6G-F480-)
• Macrophages (CD11b+Ly6C(lo)F480+) 
CD45-APCefluor 780 (30-F11), CD11b- efluor450 (M1/70), CD11c-PECy7 (HL3), Ly6G-PE (1A8), SiglecF-FITC (E50-2440) • Neutrophils (CD45+CD11b+Ly6G(hi))
• Eosinophils (CD45+ CD11c- SiglecF+) 
Lineage *CD3ξ (145-2C11), CD4 (RM4-5), CD19 (1D3), CD11b (M170), CD11c (N418), Gr1 (RB6-8C5), NK1.1 (PK136), FcξRI (MAR-1), Ter119 (TED119)] all on FITC background, ICOS-APC (C398.4A), CD25-PE (PC61.5) • ILC2 (Lin-ICOS+CD25+) 
Panel numberAntibodiesPopulations
CD11b-efluor450 (M1/70), Ly6C-FITC (AL21), F480-APC (BM8), Ly6G-PE (1A8) • Classical monocytes (CD11b+Ly6C(hi)Ly6G-F480-)
• Macrophages (CD11b+Ly6C(lo)F480+) 
CD45-APCefluor 780 (30-F11), CD11b- efluor450 (M1/70), CD11c-PECy7 (HL3), Ly6G-PE (1A8), SiglecF-FITC (E50-2440) • Neutrophils (CD45+CD11b+Ly6G(hi))
• Eosinophils (CD45+ CD11c- SiglecF+) 
Lineage *CD3ξ (145-2C11), CD4 (RM4-5), CD19 (1D3), CD11b (M170), CD11c (N418), Gr1 (RB6-8C5), NK1.1 (PK136), FcξRI (MAR-1), Ter119 (TED119)] all on FITC background, ICOS-APC (C398.4A), CD25-PE (PC61.5) • ILC2 (Lin-ICOS+CD25+) 

Flow cytometric analysis

Samples were acquired on a BD FACSAria flow cytometer equipped with four lasers, and capable of detecting up to 17 fluorochromes. Data were analyzed using the FlowJo software 10.5.3 (Treestar, Ashland, OR). Voltages were set and the compensation matrix was computed based on unstained and single stained controls. Fluorescence minus one (FMO) controls were used to set gates. From each sample, a total of 0.5–1 × 106 events were collected and doublets were excluded from the analysis using FSC (Area) versus SSC (Height). Dead cells were excluded using DAPI staining. All data percentages were calculated from total live cells or from CD45+ cells.

Statistical analysis

All analyses were performed using GraphPad Prism 8 (GraphPad Software, La Jolla, CA). Data are presented as means or fold changes ± standard error of the mean (SEM). Differences among experimental groups were analyzed for statistical significance using one-way analysis of variance (ANOVA) if there was one independent variable or two-way ANOVA if there were two independent variables. To adjust for multiple comparisons, we performed Tukey’s post-hoc test, which maintains overall type I error (α) at 5%. P-value <0.05 was considered statistically significant. Mortality rates were evaluated by the Kaplan–Meier method and survival curves were compared using the log rank test.

Results

IL-33 treatment worsens cardiac dysfunction 7 days post-MI

Induction of MI decreased ejection fraction (EF), fractional shortening (FS), and cardiac output (CO) significantly at D1 in all MI groups (****P<0.0001 vs. Baseline; Figure 1A–C) indicating successful ligation of the LAD coronary artery. There was a progressive decline in all hemodynamic parameters (EF, FS, and CO) between days 1 and 4 post-MI, but not to a significant extent (Figure 1A–C). Comparing D1 and D7 post-MI, a significant decrease in EF (**P<0.01), FS (*P<0.05), and CO (**P<0.01), was observed in the IL-33 treated MI group, but not the vehicle-treated MI group, indicating a worsened adverse LV remodeling with IL-33 treatment (Figure 1A–C). Of note, EF decreased significantly at D7 post-MI in the IL-33 treated group compared with the vehicle-treated group at the same time point (Figure 1A, *P<0.05). LV end-systolic and diastolic volumes and diameters (LVESV, LVEDV, LVESD, and LV end-diastolic diameter (LVEDD)) (normalized to tibia length) increased progressively and significantly as early as day 1 post-MI in all groups regardless of the treatment (Figure 2A–F). However, the MI group treated with IL-33 showed substantially higher increases in LVESV, LVEDV, LVESD, and LVEDD at 7 days post-MI compared with the vehicle-treated MI group, indicating worsened cardiac dysfunction (Figure 2A–F). Moreover, IL-33 treated MI group experienced a significant decrease in EF (Figure 1A, ****P<0.0001), and increase in LVESV, LVEDV, LVESD, and LVEDD (Figure 2A–D, ***P<0.001 to ****P<0.0001) between days 4 and 7 post-MI that was not observed in the vehicle-treated MI group. No significant changes in hemodynamic parameters were observed in any sham-operated groups (data not shown).

Functional cardiac parameters 4 and 7 days post-MI in vehicle-treated and IL-33 treated mice

Figure 1
Functional cardiac parameters 4 and 7 days post-MI in vehicle-treated and IL-33 treated mice

(A) EF, (B) FS, (C) CO. Bar graph data are mean ± SEM. *P<0.05, **P<0.01, ****P<0.0001.

Figure 1
Functional cardiac parameters 4 and 7 days post-MI in vehicle-treated and IL-33 treated mice

(A) EF, (B) FS, (C) CO. Bar graph data are mean ± SEM. *P<0.05, **P<0.01, ****P<0.0001.

Increased left ventricular volume and diameter with IL-33 treatment 7 days post-MI: analysis of LV end-systolic and diastolic volume and diameter

Figure 2
Increased left ventricular volume and diameter with IL-33 treatment 7 days post-MI: analysis of LV end-systolic and diastolic volume and diameter

(A) LVESV; (B) LVEDV; (C) LVESD; (D) LVEDD. Representative B-mode and M-mode (E,F) echocardiographic images obtained in mice before undergoing LAD ligation (baseline (BL)), at day 1 post-MI (D1), and at day 4 or day 7 post MI (D4), (D7) for mice treated with IL-33 or its vehicle (PBS). Echocardiographic analyses revealed impaired contractile function with IL-33 treatment 7 days post-MI when compared with MI+vehicle at 7days. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Figure 2
Increased left ventricular volume and diameter with IL-33 treatment 7 days post-MI: analysis of LV end-systolic and diastolic volume and diameter

(A) LVESV; (B) LVEDV; (C) LVESD; (D) LVEDD. Representative B-mode and M-mode (E,F) echocardiographic images obtained in mice before undergoing LAD ligation (baseline (BL)), at day 1 post-MI (D1), and at day 4 or day 7 post MI (D4), (D7) for mice treated with IL-33 or its vehicle (PBS). Echocardiographic analyses revealed impaired contractile function with IL-33 treatment 7 days post-MI when compared with MI+vehicle at 7days. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

IL-33 treatment worsens cardiac remodeling 7 days post-MI

LV weight/tibia length, an index of hypertrophy, was measured post-mortem (4 and 7 days post-MI). A significant increase in LV hypertrophy was observed in the IL-33 treated MI group when compared with the vehicle-treated MI group at 7 days post-MI (6.30 ± 0.24 vs 5.56 ± 0.16 mg/mm; *P<0.05) (Figure 3A). Moreover, MI mice treated with IL-33 showed a significant increase in pulmonary congestion in comparison with the vehicle-treated MI group at 7 days post-MI as evidenced by wet-to-dry water percentage (78.66 ± 0.57 vs 76.98 ± 0.21%; *P<0.05) (Figure 3B). Infarct size and expansion was comparable between the MI groups treated with IL-33 or vehicle at 4 days post-MI (30.35 ± 1.76 vs 28.17 ± 3.78%). However, infarct expansion was more pronounced at 7 days in both MI groups, but to a greater extent in the IL-33 treated group (59.03 ± 1.69 vs 40.58 ± 3.51%; *P<0.05), indicating altered LV remodeling with IL-33 treatment following MI (Figure 3C,D).

Increased adverse left ventricular remodeling and death with IL-33 treatment post-MI

Figure 3
Increased adverse left ventricular remodeling and death with IL-33 treatment post-MI

(A) Variation of LV weight normalized to tibia length at 4 and 7 days post-LAD ligation or sham-operation. (B) Percentage of retained water in the lungs represented as degree of pulmonary congestion at 4 and 7 days. (C,D) Infarct size and representative images at 4 and 7 days post-MI, evaluated by TTC staining. (E,F) Kaplan–Meier survival curves for mice subjected to MI at 4 and 7 days. Bar graph data are mean ± SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Figure 3
Increased adverse left ventricular remodeling and death with IL-33 treatment post-MI

(A) Variation of LV weight normalized to tibia length at 4 and 7 days post-LAD ligation or sham-operation. (B) Percentage of retained water in the lungs represented as degree of pulmonary congestion at 4 and 7 days. (C,D) Infarct size and representative images at 4 and 7 days post-MI, evaluated by TTC staining. (E,F) Kaplan–Meier survival curves for mice subjected to MI at 4 and 7 days. Bar graph data are mean ± SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

IL-33 treatment increases mortality rate post-MI

Kaplan–Meier survival curve analysis showed a tendency toward decreased survival between days 1 and 4 in MI mice treated with IL-33 compared with vehicle-treated group (Figure 3E) (n=22 with 81.82% survival vs n=17 with 94.12% survival). However, a significant increase in mortality rate was observed by 7 days post-MI in the IL-33 treated group in comparison with vehicle-treated MI group (Figure 3F) (n=46 with 50.0% survival vs n=38 with 73.68% survival); most of the mice died between days 3 and 5 post-MI and upon autopsy, cardiac rupture was observed. None of the mice died from sham operation in both groups (IL-33 treated: n=29; vehicle-treated: n=29).

IL-33 treatment increases hypertrophy and fibrosis 7 days post-MI

Histological assessment revealed enlarged cardiomyocyte CSA and increased fibrosis in both MI groups (MI+vehicle and MI+IL-33) compared with the sham-operated groups at 7 days post-MI. Treatment with IL-33, however, further increased the degree of hypertrophy (399.5 ± 13.2 vs 284.5 ± 21.08 μm2; *P<0.05) (Figure 4A) and fibrosis (30.88 ± 1.85 vs 14.35 ± 1.99%; ***P<0.0001) (Figure 4B) 7 days post-MI compared with the vehicletreated MI group.

Administration of IL-33 in mice significantly enhances cardiac remodeling (fibrosis and hypertrophy) in vivo at 7 days

Figure 4
Administration of IL-33 in mice significantly enhances cardiac remodeling (fibrosis and hypertrophy) in vivo at 7 days

(A) Quantification of myocyte CSA and representative H&E stained cross-sections at the mid-ventricle level of LAD-ligated mice treated with IL-33 or vehicle for 7 days. (B) Quantification of fibrosis and representative MTC stained cross-sections at the mid-ventricle level of LAD ligated mice treated with IL-33 or vehicle for 7 days. IL-33 treatment exacerbates cardiac remodeling (fibrosis, and hypertrophy) post-MI when compared with the MI mice treated with vehicle (n=4 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Figure 4
Administration of IL-33 in mice significantly enhances cardiac remodeling (fibrosis and hypertrophy) in vivo at 7 days

(A) Quantification of myocyte CSA and representative H&E stained cross-sections at the mid-ventricle level of LAD-ligated mice treated with IL-33 or vehicle for 7 days. (B) Quantification of fibrosis and representative MTC stained cross-sections at the mid-ventricle level of LAD ligated mice treated with IL-33 or vehicle for 7 days. IL-33 treatment exacerbates cardiac remodeling (fibrosis, and hypertrophy) post-MI when compared with the MI mice treated with vehicle (n=4 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

IL-33 treatment increases cardiac BAX/BCL2 mRNA levels and DNA fragmentation

mRNA expression levels of the apoptosis-regulating genes BAX and BCL2 are shown in Figure 5 at 4 and 7 days post-MI: BAX (Figure 5A,D); BCL2 (Figure 5B,E). BAX/BCL-2 ratio increased in both MI groups at 4 days post-MI, but only significantly in the IL-33 treated MI group compared with IL-33 treated sham group (1.61 ± 0.13 vs 0.90 ± 0.10 fold change; *P<0.05) (Figure 5C). At 7 days post- MI, mRNA expression levels of the BAX/BCL2 ratio returned to baseline in the vehicle-treated MI group, but remained significantly higher in IL-33 treated MI group compared with the vehicle-treated MI group and IL-33 treated sham group, respectively (1.82 ± 0.38 vs 0.99 ± 0.06 fold change; *P<0.05 and 1.82 ± 0.38 vs 0.68 ± 0.18 fold change; **P<0.01) (Figure 5F). To explore whether IL-33 affects cardiomyocyte cell death, a TUNEL assay was performed on myocardial sections harvested 4 and 7 days post-MI. IL-33 significantly increased cardiomyocyte DNA fragmentation in the IL-33 treated MI group compared with all other groups at 4 days post-MI (****P<0.0001) (Figure 5G,H). At 7 days, TUNEL-stained nuclei were significantly elevated in both MI groups, but to a significantly higher extent in the IL-33 treated MI group in comparison with the MI group treated with vehicle (***P<0.001) (Figure 5G,I). These results indicate that the administration of IL-33 in the presence of MI increases the susceptibility to cardiomyocyte death which may contribute to increased infarct size.

IL-33 administration increases cardiomyocyte apoptosis at 4 and 7 days post-MI

Figure 5
IL-33 administration increases cardiomyocyte apoptosis at 4 and 7 days post-MI

Normalized BAX and BCL2 gene expression and BAX/BCL2 ratio by quantitative RT-PCR at 4 (AC) and 7 days (DF) post-MI (n=4–6 per group) showing increased BAX/BCL2 ratio at both time points. Number of TUNEL positive cardiomyocytes at 4 and 7 days post MI with representative figures (GI). DNA fragmentation increases with IL-33 treatment at 4 and 7 days post-MI. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, ##P<0.01 (MI+vehicle 7d vs MI+vehicle 4d) (n=3–4 per group).

Figure 5
IL-33 administration increases cardiomyocyte apoptosis at 4 and 7 days post-MI

Normalized BAX and BCL2 gene expression and BAX/BCL2 ratio by quantitative RT-PCR at 4 (AC) and 7 days (DF) post-MI (n=4–6 per group) showing increased BAX/BCL2 ratio at both time points. Number of TUNEL positive cardiomyocytes at 4 and 7 days post MI with representative figures (GI). DNA fragmentation increases with IL-33 treatment at 4 and 7 days post-MI. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, ##P<0.01 (MI+vehicle 7d vs MI+vehicle 4d) (n=3–4 per group).

IL-33 treatment affects cardiac and plasma inflammatory cytokines post-MI

Protein expression of representative pro-inflammatory cytokines was quantified by Western blot and GM-CSF plasma levels were quantified by ELISA. Four days after MI, cardiac active IL-1β protein levels increased significantly in the vehicle-treated MI group when compared with the vehicle-treated sham-operated group (4.64 ± 1.28 vs 1.00 ± 0.18 fold change; *P<0.05) (Figure 6A). Cardiac active IL-1β tended to increase in the sham and MI groups treated with IL-33 without reaching significance (Figure 6A). At 7 days post-MI, cardiac active IL-1β protein levels returned to baseline in all groups except for the vehicle-treated MI group, which became significantly more elevated than the IL-33 treated MI group (3.38 ± 1.03 vs 0.69 ± 0.19 fold change; *P<0.05) (Figure 6B).

IL-33 treatment affects inflammatory cytokine protein expression

Figure 6
IL-33 treatment affects inflammatory cytokine protein expression

(A,B) IL-1β protein expression with representative bands at 4 and 7 days showing an increase in IL-1β cytokine expression in the MI group treated with vehicle at 4 days (P<0.05) and a significant decrease in the MI group treated with IL-33 in comparison with the vehicle-treated group at 7 days. (C,D) TNF-α protein expression with representative bands at 4 and 7 days showing decreased TNF-α cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05) (n=4 or 5 per group). (E) ELISA results for GM-CSF plasma protein concentrations at 4 and 7 days post sham or MI operation. Increased plasma concentrations of GM-CSF at 4 days with IL-33 treatment (n=4 or 5 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Figure 6
IL-33 treatment affects inflammatory cytokine protein expression

(A,B) IL-1β protein expression with representative bands at 4 and 7 days showing an increase in IL-1β cytokine expression in the MI group treated with vehicle at 4 days (P<0.05) and a significant decrease in the MI group treated with IL-33 in comparison with the vehicle-treated group at 7 days. (C,D) TNF-α protein expression with representative bands at 4 and 7 days showing decreased TNF-α cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05) (n=4 or 5 per group). (E) ELISA results for GM-CSF plasma protein concentrations at 4 and 7 days post sham or MI operation. Increased plasma concentrations of GM-CSF at 4 days with IL-33 treatment (n=4 or 5 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Cardiac TNF-α expression increased significantly in the vehicle-treated MI group compared with the relative sham-operated group at 4 days (2.55 ± 0.24 vs 1.00 ± 0.05 fold change; *P<0.05) (Figure 6C). By itself, IL-33 increased cardiac TNF-α levels at 4 days (2.43 ± 0.56 (sham+IL-33) vs 1.00 ± 0.05 (sham+vehicle) fold change). However, TNF-α protein levels were attenuated in the IL-33 treated MI group 4 days post-MI when compared with the MI group treated with vehicle (0.59 ± 0.14 vs 2.55 ± 0.24 fold change; *P<0.05) (Figure 6C). At 7 days post-MI, TNF-α protein levels in all groups were at baseline with no significant differences among them (Figure 6D).

Plasma GM-CSF levels were significantly elevated in the IL-33 treated MI group at 4 days post-MI compared with all other groups (**P<0.01 to ****P<0.0001) (Figure 6E). Plasma GM-CSF decreased at 7 days post-MI 51.97 ± 16.78 (pg/ml) (MI+IL-33 D7) vs (128.1 ± 27.75 (pg/ml) (MI+IL-33 D4); **P<0.01), but remained insignificantly more elevated than all other groups at the same time point. The sham-operated group treated with IL-33 showed a slight but insignificant increase in GM-CSF plasma concentrations compared with all vehicle-treated groups at both 4 and 7 days post-MI (Figure 6E).

IL-33 treatment increases MMP2 and MMP9 mRNA expression 7 days post-MI

MMP9 mRNA levels significantly increased in the IL-33 treated MI group compared with all other groups at 4 and 7 days post-MI (*P<0.05, **P<0.01 and ****P<0.0001) (Figure 7A,B). MMP2, however, did not increase in any group at 4 days (Figure 7C), but significantly increased at 7 days (Figure 7D) in the IL-33 treated MI group compared with the vehicle-treated sham group (4.46 ± 1.25 vs 1.00 ± 0.07 fold change; *P<0.05). These results suggest that the administration of IL-33 in the presence of MI potentially enhances extracellular matrix (ECM) degradation.

Up-regulation of matrix metalloproteinases with IL-33 treatment at 7 days

Figure 7
Up-regulation of matrix metalloproteinases with IL-33 treatment at 7 days

(A,B) Normalized MMP9 gene expression by quantitative RT-PCR at 4 and 7 days showing up-regulation of MMP9 with IL-33 treatment at 4 and 7 days (P<0.05). (C,D) Normalized MMP2 gene expression by quantitative RT-PCR at 4 and 7 days showing up-regulation of MMP2 with IL- 33 treatment at 7 days post-MI (P<0.05) (n=4–6 per group). *P<0.05, **P<0.01, ****P<0.0001.

Figure 7
Up-regulation of matrix metalloproteinases with IL-33 treatment at 7 days

(A,B) Normalized MMP9 gene expression by quantitative RT-PCR at 4 and 7 days showing up-regulation of MMP9 with IL-33 treatment at 4 and 7 days (P<0.05). (C,D) Normalized MMP2 gene expression by quantitative RT-PCR at 4 and 7 days showing up-regulation of MMP2 with IL- 33 treatment at 7 days post-MI (P<0.05) (n=4–6 per group). *P<0.05, **P<0.01, ****P<0.0001.

IL-33 treatment promotes type 2 cytokines release

IL-33 administration in the MI group for 4 days resulted in a significant increase in IL-4, IL-13, and IL-10 cardiac protein expression (*P<0.05 and **P<0.01 vs. sham+vehicle) (Figure 8A,C,E). Moreover, IL-13 and IL-10 protein expression at 4 days was significantly more elevated in IL-33 treated MI group compared with the vehicle-treated MI group (4.61 ± 0.89 vs 1.83 ± 0.30 fold change; **P<0.01) and (4.38 ± 1.56 vs 1.65 ± 1.56 fold change; *P<0.05) (Figure 8C,E), respectively. At 7 days, IL-4, IL-13, and IL-10 protein expression returned to baseline in all groups (Figure 8B,D,F). Treatment with IL-33 increased IL-5 plasma concentrations in comparison with the vehicle-treated groups at 4 days in MI and sham groups (97.56 ± 4.94 (pg/ml) MI+IL-33 vs 0.44 ± 0.21 (pg/ml) MI+vehicle) (****P<0.0001) and (95.10 ± 0.55 (pg/ml) sham+IL-33 vs 0.51 ± 0.29 (pg/ml) sham+vehicle) (****P<0.0001), respectively (Figure 8G). Seven days post-MI, IL-5 plasma concentrations decreased in the IL-33 treated groups compared with their counterparts at 4 days (97.56 ± 4.94 (pg/ml) (MI+IL-33 D4) vs 23.92 ± 6.73 (pg/ml) (MI+IL-33 D7) (****P<0.0001) and sham groups (95.10 ± 0.55 (pg/ml) (sham+IL-33 D4) vs 56.19 ± 6.74 (pg/ml) (sham+IL-33 D7) (***P<0.001)), but remained significantly more elevated compared with the vehicle-treated MI and sham groups at 7 days post-MI (23.92 ± 6.73 (pg/ml) (MI+IL-33) vs 0.45 ± 0.06 (pg/ml) (MI+vehicle); (*P<0.05)) and (56.19 ± 6.74 (pg/ml) (sham+IL-33) vs 1.55 ± 0.60 (pg/ml) (sham+vehicle); (***P<0.001)) (Figure 8G). No plasma IL-5 levels were detected in vehicle-treated MI and sham groups.

Increased type 2 cytokine production with IL-33 treatment

Figure 8
Increased type 2 cytokine production with IL-33 treatment

(A,B) IL-4 protein expression with representative bands at 4 and 7 days showing increased IL-4 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05) (n=3–4 per group). (C,D) IL-13 protein expression with representative bands at 4 and 7 days showing increased IL-13 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05). (E,F) IL-10 protein expression with representative bands at 4 and 7 days showing increased IL-10 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05). (G) Increased plasma concentrations of IL-5 at 4 days with IL-33 treatment. Plasma concentrations of IL-5 were examined by ELISA at 4 and 7 days post-MI (sham animals n=3 per group; MI animals n=5 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Figure 8
Increased type 2 cytokine production with IL-33 treatment

(A,B) IL-4 protein expression with representative bands at 4 and 7 days showing increased IL-4 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05) (n=3–4 per group). (C,D) IL-13 protein expression with representative bands at 4 and 7 days showing increased IL-13 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05). (E,F) IL-10 protein expression with representative bands at 4 and 7 days showing increased IL-10 cytokine expression in the MI group treated with IL-33 for 4 days (P<0.05). (G) Increased plasma concentrations of IL-5 at 4 days with IL-33 treatment. Plasma concentrations of IL-5 were examined by ELISA at 4 and 7 days post-MI (sham animals n=3 per group; MI animals n=5 per group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

IL-33 treatment modulates neutrophil and monocyte/macrophage production, mobilization, and recruitment

Neutrophils and monocytes were identified as CD45+CD11b+Ly6G(hi) and CD11b+Ly6C(hi)Ly6G-F480- cells, respectively. Compared with day 1, neutrophil and Ly6C(hi) monocyte production in the bone marrow peaked at 3 days in all experimental groups including the vehicle-treated sham-operated group (Figures 9A and 10A). At 7 days, bone marrow neutrophil and Ly6C (hi) levels decreased significantly in the IL-33 treated MI group compared with the levels observed at day 3 (neutrophils: 46.37 ± 1.58% (MI+IL33 D3) vs 29.85 ± 1.94% (MI+IL33 D7) *P<0.05) (Ly6C (hi): 16.80 ± 1.75% (MI+IL-33 D3) vs 5.59 ± 0.99% (MI+IL-33 D7); ****P<0.0001) (Figures 9A and 10A). Moreover, bone marrow neutrophils at 7 days were significantly lower in the IL-33 treated MI group in comparison with the vehicle-treated MI group at the same time point (29.85 ± 1.94 vs 46.13 ± 2.28%; *P<0.05) (Figure 9A). In the spleen, compared with day 1, neutrophils peaked at 3 days post-MI in the IL-33 treated group (10.72 ± 1.47 vs 4.73 ± 0.83% D1; *P<0.05) where levels were significantly higher than in the vehicle-treated MI group at the same time point (10.72 ± 1.47 vs 5.01 ± 0.93% (MI+vehicle D3); *P<0.05, Figure 9B). Neutrophil circulation in the blood culminated at day 1 in all experimental groups and reached its lowest point at 7 days where levels in the IL-33 treated MI group were significantly lower than in the vehicle-treated group at the same time point (7.07 ± 2.95 vs 26.62 ± 6.54%; *P<0.05) (Figure 9C). At 7 days, Ly6C (hi) levels in the spleen and in the blood were significantly lower in the IL-33 treated MI group when compared with the levels observed in the vehicle-treated MI group (Figure 10B,C; *P<0.05). Of note, neutrophils and monocytes increased in the hearts of both experimental groups (MI+vehicle and MI+IL-33) on day 1 post-MI, and decreased significantly and concomitantly on day 7 post-MI (Figures 9D and 10D).

Comparable neutrophil resolution in the heart between IL-33-treated and vehicle-treated MI groups at 7 days post-MI

Figure 9
Comparable neutrophil resolution in the heart between IL-33-treated and vehicle-treated MI groups at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of neutrophil percentage calculated out of CD45+ cells from, (A) the bone marrow (BM), neutrophil production in the bone marrow peaks at day 3 in all experimental groups when compared with day 1. (B) Spleen, neutrophil infiltration peaks at day 3 in the spleen in the MI group treated with IL-33. (C) Blood, neutrophils are at their highest levels at day 1 and decrease at day 7 in all experimental groups, and (D) heart, neutrophil infiltration drops significantly at day 7 in both MI groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5-6 in LAD-ligated groups).

Figure 9
Comparable neutrophil resolution in the heart between IL-33-treated and vehicle-treated MI groups at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of neutrophil percentage calculated out of CD45+ cells from, (A) the bone marrow (BM), neutrophil production in the bone marrow peaks at day 3 in all experimental groups when compared with day 1. (B) Spleen, neutrophil infiltration peaks at day 3 in the spleen in the MI group treated with IL-33. (C) Blood, neutrophils are at their highest levels at day 1 and decrease at day 7 in all experimental groups, and (D) heart, neutrophil infiltration drops significantly at day 7 in both MI groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5-6 in LAD-ligated groups).

Dynamics of proinflammatory monocytes at different timepoints with and without IL-33 treatment

Figure 10
Dynamics of proinflammatory monocytes at different timepoints with and without IL-33 treatment

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of monocytes percentage calculated out of total live cells from (A) the bone marrow (BM), monocyte production in the bone marrow peaks at day 3 in all experimental groups when compared with day 1. (B) Spleen, a significant decrease in monocyte infiltration in the spleen is observed in the MI group treated with IL-33 when compared with the MI group treated with vehicle at day 7. (C) Blood, circulating monocytes in the blood decrease significantly at day 7 in the MI group treated with IL-33 when compared with the MI group treated with vehicle, and (D) heart, monocyte levels are at their highest in both MI groups at day 1 and decrease gradually over time. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5–6 in LAD-ligated groups).

Figure 10
Dynamics of proinflammatory monocytes at different timepoints with and without IL-33 treatment

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of monocytes percentage calculated out of total live cells from (A) the bone marrow (BM), monocyte production in the bone marrow peaks at day 3 in all experimental groups when compared with day 1. (B) Spleen, a significant decrease in monocyte infiltration in the spleen is observed in the MI group treated with IL-33 when compared with the MI group treated with vehicle at day 7. (C) Blood, circulating monocytes in the blood decrease significantly at day 7 in the MI group treated with IL-33 when compared with the MI group treated with vehicle, and (D) heart, monocyte levels are at their highest in both MI groups at day 1 and decrease gradually over time. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5–6 in LAD-ligated groups).

Macrophages were identified as CD11b+F480+Ly6C-. Compared with day 1, macrophages significantly peaked with IL-33 treatment in the bone marrow as early as 3 days post-MI in the IL-33 treated sham and MI groups, and remained elevated when compared with the vehicle-treated groups at 7 days post-MI (Figure 11A). In the spleen and blood, macrophages increased significantly with IL-33 treatment and culminated at 7 days post-MI (Figure 11B,C). In the heart, MI induced a significant increase in macrophage levels in the vehicle-treated group at 3 days post-MI when compared with day 1 (Figure 11D). However, a significant increase in macrophage levels was observed in the heart of the IL-33 treated MI group at 7 days when compared with the same group at day 1 and day 3 post-MI (Figure 11D). Furthermore, macrophage levels in the IL-33 treated MI group at 7 days were significantly more elevated than the vehicle-treated MI group at the same time point (Figure 11D).

Increased macrophage levels with IL-33 treatment at 7 days post-MI

Figure 11
Increased macrophage levels with IL-33 treatment at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of macrophage percentage calculated out of total live cells from, (A) the bone marrow (BM) macrophages in the bone marrow increase significantly with IL-33 treatment at day 3, (B) spleen, macrophage levels start increasing with IL-33 treatment as early as day 3 and become significantly more elevated in the MI group treated with IL-33 at day 7, (C) blood, a significant increase in macrophage circulation in the blood is observed with IL-33 treatment at day 7, and (D) heart, macrophage levels start increasing in the heart at day 3 and become significantly more pronounced in the MI group treated with IL-33 at day 7. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5–6 in LAD-ligated groups).

Figure 11
Increased macrophage levels with IL-33 treatment at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of macrophage percentage calculated out of total live cells from, (A) the bone marrow (BM) macrophages in the bone marrow increase significantly with IL-33 treatment at day 3, (B) spleen, macrophage levels start increasing with IL-33 treatment as early as day 3 and become significantly more elevated in the MI group treated with IL-33 at day 7, (C) blood, a significant increase in macrophage circulation in the blood is observed with IL-33 treatment at day 7, and (D) heart, macrophage levels start increasing in the heart at day 3 and become significantly more pronounced in the MI group treated with IL-33 at day 7. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse (n=3 in sham-operated groups and n=5–6 in LAD-ligated groups).

IL-33 treatment elicits eosinophilia

Eosinophils were identified as CD45+SiglecF+CD11c-. IL-33 is known to directly facilitate the maturation of eosinophils by enhancing their survival, activation, and adhesion [47]. IL-33 treatment for 7 days induced a drastic increase in eosinophils in all organs (bone marrow, spleen, blood, and heart). Percentage of eosinophil out of CD45+ cells ranged between (8.81 ± 1.23 and 42.37 ± 5.89%) in the IL-33-treated sham-operated group and (10.02 ± 1.74 and 62.26 ± 5.56%) in the IL-33-treated MI group in all organs at 7 days (Figure 12A–D).

IL-33 induces eosinophilia at day 7 regardless of the surgical intervention

Figure 12
IL-33 induces eosinophilia at day 7 regardless of the surgical intervention

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of eosinophil percentage calculated out of CD45+ cells, (A) the bone marrow (BM), (B) spleen, (C) blood, and (D) heart. Eosinophil levels start increasing as early as day 3 in the sham and MI groups treated with IL-33 and become significantly more increased at day 7 in these two groups in all tissues.*P<0.05, ****P<0.0001. Each dot represents one mouse (n=3–4 in sham-operated groups and n=5–6 in LAD-ligated groups).

Figure 12
IL-33 induces eosinophilia at day 7 regardless of the surgical intervention

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of eosinophil percentage calculated out of CD45+ cells, (A) the bone marrow (BM), (B) spleen, (C) blood, and (D) heart. Eosinophil levels start increasing as early as day 3 in the sham and MI groups treated with IL-33 and become significantly more increased at day 7 in these two groups in all tissues.*P<0.05, ****P<0.0001. Each dot represents one mouse (n=3–4 in sham-operated groups and n=5–6 in LAD-ligated groups).

IL-33 treatment increases ILC2 levels at 7 days post-MI

ILC2 were identified as Lin-ICOS+CD25+. Although present in all organs in a very small percentage, ILC2 seemed to increase with IL-33 treatment. In the bone marrow, compared with day 1, a significant increase in ILC2s was observed at 3 days in the IL-33 treated sham-operated group (0.14 ± 0.01% (D1) vs 0.46 ± 0.11% (D7); ***P<0.001) (Figure 13A). Moreover, treatment of the sham-operated group with IL-33 increased ILC2 production in the blood at 7 days when compared with the vehicle-treated sham-operated group at the same time point (0.014 ± 0.014 vs 0.30 ± 0.06%; *P<0.05) (Figure 13C). In the spleen and in the heart, a tendency toward an increase in ILC2 percentage was observed in the IL-33-treated sham-operated group but without reaching significance. ILC2 significantly increased in the IL-33-treated MI group and ranged between (0.20 and 1.26)% of the total number of cells in all organs at 7 days (Figure 13A–D).

Treatment with IL-33 increases ILC2 levels at 7 days post-MI

Figure 13
Treatment with IL-33 increases ILC2 levels at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of ILC2 percentage calculated out of total live cells from, (A) the bone marrow (BM), ILC2 levels start increasing as early as day 3 with IL-33 treatment and become significantly more elevated in the MI group treated with IL-33 at day 7, (B) spleen, ILC2 levels peak in the spleen at day 7 in the MI group treated with IL-33, (C) blood, ILC2 circulation in the blood increases significantly at day 7 in the sham and MI groups treated with IL-33, and (D) heart, ILC2s increase significantly in the heart at day 7 in the MI group treated with IL-33. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse. (n=3 in sham-operated groups and n=5–6 in LAD- ligated groups).

Figure 13
Treatment with IL-33 increases ILC2 levels at 7 days post-MI

Time course variation (day 1 (D1), day 3 (D3) and day 7 (D7) post-surgery) of ILC2 percentage calculated out of total live cells from, (A) the bone marrow (BM), ILC2 levels start increasing as early as day 3 with IL-33 treatment and become significantly more elevated in the MI group treated with IL-33 at day 7, (B) spleen, ILC2 levels peak in the spleen at day 7 in the MI group treated with IL-33, (C) blood, ILC2 circulation in the blood increases significantly at day 7 in the sham and MI groups treated with IL-33, and (D) heart, ILC2s increase significantly in the heart at day 7 in the MI group treated with IL-33. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Each dot represents one mouse. (n=3 in sham-operated groups and n=5–6 in LAD- ligated groups).

IL-33 treatment induces splenomegaly

In contrast with the normal spleen size and weight observed in the vehicle-treated sham and MI mice (ranging between 4.19 ± 0.42 and 4.81 ± 0.19 mg/mm), administration of IL-33 for 4 and 7 days induced a significant increase in spleen weight in a time-dependent manner regardless of the surgical intervention (Supplementary Figure S1). Increases in 1.73-folds and 2.6-folds in spleen weights were observed between the vehicle-treated and IL-33-treated sham-operated groups at 4 and 7 days, respectively. The variation in spleen weights in the IL-33-treated MI groups was comparable with that observed in the sham-operated groups where increases in 1.7-folds and 3-folds in spleen weights were seen between the vehicle-treated and IL-33-treated MI groups at 4 and 7 days respectively. These findings are consistent with previous data showing increase in spleen size and weight with IL-33 treatment [4,48].

IL-33 treatment up-regulated cardiac sST2 expression at 7 days in the presence or absence of MI

mRNA levels of cardiac sST2 were measured at 4 and 7 days in all groups treated with IL-33 or vehicle. sST2 levels were not changed at 4 days in all sham and MI groups (Supplementary Figure S2A). However, at 7 days, sST2 mRNA levels increased significantly in the sham and MI groups treated with IL33 compared with the sham group treated with vehicle (P<0.01 and P<0.001, respectively). MI increased sST2 levels in the vehicle-treated group 7 days post-MI with no significance when compared with the relative sham group. Administration of IL-33 significantly up-regulated sST2 cardiac expression in the MI group in comparison with vehicle-treated MI group (P<0.01) (Supplementary Figure S2B). The receptor for IL-33 (ST2) is found primarily on many ‘allergy associated’ target cells, including, helper T cells (Th2), eosinophils, basophils, mast cells and ILC2 [49]. IL-33 participates in the synthesis and release of IL-5 from these target cells thereby possibly promoting eosinophilia [4].

IL-33 plasma availability peaked at 4 days and decreased at 7 days while remaining significantly more elevated than in the MI group treated with vehicle (Supplementary Figure S2C). It is possible that sST2 levels are increased in the plasma at 7 days, therefore acting as a decoy receptor to IL-33 and decreasing its availability in the plasma at 7 days. The dynamic expression of plasma IL-33 was measured by ELISA at 4 and 7 days post-MI (Supplementary Figure S2B). Plasma IL-33 concentrations peaked at 4 days in the sham and MI groups treated with IL-33 (Supplementary Figure S2C), and decreased significantly at 7 days in both groups but remained significantly higher than the vehicle-treated sham and MI groups (Supplementary Figure S2C).

Decreased protein and gene expression of profibrotic markers with IL-33 post-MI

Cardiac protein expression of the fibrogenic cytokine TGF-β was not altered by IL-33 or MI at day 4. However, at 7 days, levels of TGF-β increased in the sham+IL-33 and MI+vehicle groups without reaching significance. Moreover, TGF-β protein expression decreased significantly in the MI group treated with IL-33 when compared with the MI group treated with vehicle at 7 days (0.84 ± 0.20 vs 2.29 ± 0.50 fold change; *P<0.05) (Supplementary Figure S3A,B). The transdifferentiation of fibroblasts into myofibroblasts is characterized by the up-regulation of α-SMA [50]. α-SMA cardiac expression also decreased at 7 days post-MI in the IL-33 treated MI group compared with the MI group treated with vehicle (0.68 ± 0.11 vs 1.63 ± 0.31 fold change; *P<0.05) (Supplementary Figure S3C,D). Gene expression of connective tissue growth factor (CTGF), a matrix-associated protein, significantly increased in the MI group treated with vehicle compared with the sham vehicle-treated group at 4 and 7 days post-MI (16.39 ± 2.69 vs 1.00 ± 0.03 fold change; ***P<0.001). In contrast, IL-33 treatment significantly decreased CTGF gene expression at 4 days post-MI compared with the vehicle-treated MI group (6.07 ± 1.22 vs 16.39 ± 2.69 fold change; **P<0.01) (Supplementary Figure S3E). of note, CTGF gene expression remained more elevated in the vehicle-treated MI group at 7 days when compared with the sham-operated group (4.87 ± 0.72 vs 1.00 ± 0.21 fold change; *P<0.05) (Supplementary Figure S3F). These results indicate that administration of IL-33 in MI mice attenuates cardiac profibrotic markers in MI mice.

Discussion

Due to the limited capacity of the adult mammalian heart to regenerate, the healing process post-MI is phasic, relying mainly on an early sterile inflammatory response to remove the debris of dead cells followed by granulation and maturation phases to replace lost cells with fibrotic tissue and strengthen scar formation. Depending on the clinical state, and the presence or absence of comorbidities, alteration in transition between phases such as inflammation prolongation or increased fibrosis deposition can worsen cardiac remodeling post-MI. Providing a pharmacological platform to promote appropriate transition between early remodeling phases post-MI through immunomodulatory mechanisms is gaining significant attention and constitutes the basis of the experiments presented in this manuscript.

In the present study, we assessed the reparative actions of the alarmin IL-33 on the infarcted myocardium. IL-33 was administered for 4 and 7 consecutive days following LAD coronary artery ligation or sham-operation. We observed that IL-33 was indeed effective in activating a type 2 immune response in the damaged heart, consistent with the anticipated wound healing response, as evidenced by early (day 4) increased levels of type 2 cytokines (IL-4, IL-5,and IL-13) and anti-inflammatory IL-10, and reduced levels of inflammatory TNF-α (at 4 and 7 days) and IL- 1β (7 days). Nonetheless, IL-33 was associated with a pronounced decrease in systolic function at day 7 with ventricular dilation and infarct expansion, along with increased apoptosis (increased BAX/BCL2 and TUNEL+ nuclei). The overall results of the present study reveal that IL- 33 is associated with worsened cardiac function and increased adverse cardiac remodeling in the MI mouse model. Administration of IL-33 increased mortality due to cardiac rupture, induced pulmonary congestion and cardiomyocyte apoptosis, and promoted LV hypertrophy. Despite decreased systolic function, our FACS data did not show any major changes in monocyte and neutrophil cardiac infiltration pattern in the IL-33-treated MI group when compared with the vehicle-treated group at 7 days. These results are in agreement with previously published data showing no major increases in cardiac neutrophils and monocytes despite exacerbation in cardiac dysfunction and increased myocarditis with IL-33 treatment [41]. With IL-33 treatment, increased cardiac hypertrophy and fibrosis were observed. This may reflect a compensatory response to increased infarct expansion, although it is unsettled whether the fibrosis was productive or reflected decreased ECM turnover. Overall, IL-33 treatment was associated with a decrease in profibrotic markers in the infarcted heart (CTGF, TGF-β) and in activated myofibroblasts (α-SMA), as well as an increase in MMPs that degrade the ECM. Increase in MMPs is linked to the slippage of myocyte fascicles thereby promoting wall thinning in the infarcted area leading to cardiac rupture. Previous studies have shown that MMPs are not only involved in ECM degradation, but are also implicated with the progression to heart failure [51]. Targeted deletion of MMP2 or MMP9 decreases the incidence of cardiac rupture and attenuates LV enlargement following LAD ligation in mice [52–54]. In this study, we observe increased expression of MMP2 and MMP9 at 7 days that may have contributed to wall thinning and rupture. These metalloproteases regulate ECM turnover and were shown to be produced by eosinophils and contribute to airway remodeling [55,56].

We observed as well an increase in ILC2s with IL-33 treatment in the bone marrow, spleen, and blood, as well as the myocardium that was further enhanced at day 7 in the infarcted mice. Our current data are in agreement with recently published data stating that the activation of ILC2 by IL-33 plays a pathogenic role in the heart by inducing cardiac eosinophilic infiltration and exacerbating cardiac dysfunction [30]. Whether the cardiac ILC2s originated from a resident cardiac or pericardiac pool [29] or were recruited from the mediastinal cavity [30] as suggested by others was not established. Along with type 2 Th2, ILC2s are a major source of type 2 cytokines and mediators of the actions of IL-33 at barrier sites of the body [8], and in certain cases shown to amplify inflammation via activation of eosinophils [57,58].

As previously reported [4], IL-33 treatment induced splenomegaly, which we observed was associated with a delayed accumulation of eosinophils in the spleen. This finding is consistent with a recent report stating that IL-33 positively affects eosinophil development [47]. IL-33 has also been implicated in activating mature eosinophils. For instance, IL-33 was reported to play a role in either the survival or death of human eosinophils depending upon context [47] and to stimulate nuclear factor-κB (NF-κB)-mediated inflammatory gene expression in murine eosinophils by both IL-4-independent and IL-4-dependent/autocrine mechanisms [59]. In addition, IL-33 was reported to induce degranulation and superoxide anion production of human eosinophils as effectively as IL-5 [60]. Nevertheless, differential effects of IL-33 on collagen deposition and MMP2/9 levels in sham versus MI hearts suggest that some other factor(s) might be involved in activating eosinophils.

IL-33 induced a delayed increase in eosinophils in the heart in both the absence and presence of MI. Increased plasma concentrations of IL-5 and GM-CSF (which are potent cytokines associated with eosinophil development and increased viability [61]) at 4 days may have facilitated this recruitment. The IL-33-induced increase by day 4 in IL-4 and IL-13 in the infarcted myocardium may have contributed as well [62]. Previous studies have shown a direct correlation between increased serum GM-CSF levels and impairment of the healing process post-MI by acting at a distance in the BM and locally in the heart to produce and enhance immune cells accumulation [63]. In this study, elevated serum GM-CSF levels correlated with strong eosinophil recruitment and cardiac dysfunction following IL-33 treatment post-MI. Earlier studies indicated that eosinophils are rapidly activated within 2–3 days following MI, infiltrate into the myocardium, and contribute to cardiac rupture in some patients [64,65]. Other studies have linked eosinopenia to an acute MI in patients presenting with acute coronary syndrome [66,67]. A decrease in blood eosinophils might be indicative of their accumulation in the damaged myocardium [68]. This scenario is further substantiated by evidence showing a positive correlation between higher baseline serum levels of eosinophil cationic protein (ECP) and follow-up occurrence of MACEs after PCI [69–71]. On the other hand, Shiyovich et al. [72] observed a U-shaped association between blood eosinophils within 72 h of admittance and greater risk of death in patients with acute MI, with a greater count associated with lower 1 year mortality rates. This observation was interpreted to mean that eosinophils might help control the inflammatory response.

Several studies have shown that increased sST2 expression can have a negative prognostic impact on the general cardiovascular risk profile [8,20]. For instance, sST2 mRNA was markedly increased after biomechanical strain in cultured cardiomyocytes and fibroblasts and serum sST2 levels were transiently increased as early as four hours following coronary artery ligation in mice [73] and 12 h in patients with acute MI [19]. Patients with cardiac fibrosis, hypertrophy, LV dilatation, and decreased ventricular contractility have elevated sST2 levels, which is considered an independent predictor of adverse outcomes in acute decompensated heart failure [74]. Moreover, in stable, well-treated congestive heart failure patients, elevated sST2 levels were associated with disease-specific end-points such as heart failure hospitalization and cardiovascular death [75]. Although in the present study we did not examine plasma sST2 levels, we did see an increase in cardiac sST2 mRNA levels at 7 days in our IL-33-treated MI mice, which corresponded with decreased IL-33 levels in the plasma at the same time point. Plasma IL-33 concentrations peaked at 4 days in the sham and MI groups treated with IL-33, and decreased significantly at 7 days in both groups but remained significantly higher than the vehicle-treated sham and MI groups. We therefore speculated whether sST2 levels are also increased in the plasma at 7 days, and are acting as a decoy receptor to IL-33 and decreasing consequently its availability in the plasma at 7 days.

Although the human and mouse IL-33 are only 55% identical, they both comprise 270 and 266 amino acids, respectively and have almost identical molecular weights (30 kDa human and 29.9 kDa murine) [5]. The IL-33 present in humans and mice have similar expression patterns and both orthologs are present in the nucleus and released extracellularly upon injury or necrosis [76]. Although previous investigators have used rat and human-derived IL-33 [4,32] and have shown variations in immune responses with IL-33 treatment, we used mouse recombinant IL-33 in our MI model. The administration of mouse IL-33 in the acute MI model in mice, can highly mimic the mechanisms occurring in human heart disease, and can therefore be a useful tool to elucidate the cardiovascular events arising following myocardial ischemia.

Previous studies have shown that the association of IL-33 with its transmembrane receptor (ST2L) could have protective effects on the heart. In the MI setting, Yin et al showed that IL-33 significantly decreases macrophage infiltration and alleviates inflammation in the heart, making IL-33 a potential therapeutic cytokine for cardiac dysfunction post-MI [37,38]. Despite similarities with IL-33 administration modality of this study, Yin et al. study differs in several aspects: (1) in the current study, hemodynamic parameters were collected at baseline, day 1, day 4, and day 7 post-MI. The results at day 1 clearly show that the hemodynamic parameters (EF, FS, CO, LV end-systolic volume (LVESV), LV end-diastolic volume (LVEDV), LV end-systolic diameter (LVESD), LVEDD) were in the same range in all MI groups, reflecting similar MI induction in all groups at day 1. Although no significant hemodynamic changes were observed at day 4, animals in the IL-33-treated MI group exhibited significantly decreased EF and increased LVESV, LVEDV, LVESD, LVEDD at day 7 post-MI in comparison with the vehicle- treated MI group. IL-33 administration and follow up was ethically limited to 7 days post-MI due to the very high mortality rate in the IL-33 treated MI animals (∼50%). In the Yin et al. study, LV function was assessed at day 14 and day 28 post-MI and no data were shown at day 1 post-MI to prove that both MI groups (treated with vehicle and IL-33) underwent the same degree of MI. Additionally, IL-33 treated MI groups showed extraordinarily improved cardiac function in comparison with the vehicle-treated MI group at 14 and 28 days post-MI. (2) In the present study, DNA fragmentation was assessed at 4 and 7 days post-MI and was shown to be significantly increased with IL-33 treatment post-MI. Yin et al. observed DNA fragmentation at an earlier phase (3 days post-MI only) and was shown to be decreased with IL-33 treatment. 3) The flow cytometry data in this study showed that macrophages increased in the heart 3 days post-MI in the vehicle-treated group, without being affected in any other organ such as the bone marrow, spleen and blood. These results suggest a possible local monocyte to macrophage differentiation, a process that can take place as early as day 1 post-MI [77]. No significant difference in macrophage levels in the heart were observed between the IL-33 and vehicle-treated MI groups at 3 days post-MI. However at 7 days post-MI, a significant increase in macrophage infiltration in the heart was observed in the IL-33 treated MI group in comparison with the vehicle-treated group at the same time point. In contrast, in the Yin et al. study, immunofluorescent-staining showed a significantly decreased F4/80+ macrophage infiltration in the heart in the IL-33 treated MI animals at 3 days post-MI. Macrophage levels might have changed in the heart post-MI with IL-33 treatment if they were assessed at later stages.

The present study has few limitations that should be acknowledged. Despite increased infiltration of ILC2 and eosinophils following IL-33 administration, our study did not explore the role of ILC2-deficient and eosinophil-deficient mice in the pathogenesis of MI. Moreover, the IL- 33/ST2 axis is known to activate several signaling pathways including NF-κB, mitogen activated protein kinases (MAPK) and phosphoinositide 3-kinase (PI3K) [4,78–83]. Inhibition of the PI3K signaling pathway is shown to reduce inflammation and improve outcomes in several pathological events [84–87], including MI [88]. The PI3K signaling pathway is also implicated in eosinophil chemotaxis and inhibition of the PI3K pathway was shown to impair release of eosinophils from bone marrow [89]. Future studies are warranted to explore the role of ILC2 and eosinophil KO mice and to see whether inhibition of the PI3K signaling pathway improves outcomes following IL-33 administration in the presence and absence of MI.

In conclusion, our findings indicate that IL-33 has opposing actions on the infarcted heart. On one hand, this alarmin creates a reparative phenotype in the infarcted heart through induction of a type 2 response, at the peak of inflammation-to-granulation transition, promoting a significant inflammatory resolution as early as day 4 post-MI, and inhibiting conventional prolonged inflammation by suppressing myocardial IL-1β and TNF-α levels between 4 and 7 days post-MI. On the other hand, IL-33 worsened cardiac remodeling and function and increased cardiac rupture and death. The adverse cardiac outcomes following IL- 33 treatment were mostly related to an impaired transition to the granulation phase characterized by a significant decrease in appropriate fibrotic markers and myofibroblasts formation, both being essential for the establishment of a mature scar at an early phase post-MI (Supplementary Figure S9). Granulation impairment seems to be concomitant with strong eosinophil infiltration. Of note, both neutrophil and Ly6C (hi) monocyte infiltration decreased significantly from day 3 to day 7 post-MI, and to comparable levels between the IL-33-treated and vehicle-treated MI groups, suggesting that these immune cells may not be implicated in the observed cardiac dysfunction. Whether eosinophils are ultimately and solely responsible for the adverse actions of IL-33 warrants further investigation.

Clinical perspectives

  • The IL-33/ST2 axis is associated with a number of inflammatory, immune, and allergic disorders but is reported to have protective effects on cardiac function in many cardiovascular settings including cardiac overload, abdominal aortic aneurysm, and atherosclerosis. In the present study we examined the effect of IL-33 administration on myocardial pathological changes, including ventricular remodeling, myocardial dysfunction, fibrosis, immune cell infiltration, and survival following MI.

  • Our results suggest that IL-33 is effective in activating a type 2 cytokine milieu in the damaged heart, consistent with reduced early inflammatory and pro-fibrotic response. However, IL-33 administration is associated with worsened cardiac function and adverse cardiac remodeling in the MI mouse model. IL-33 administration increased infarct size, LV hypertrophy, cardiomyocyte death, and overall mortality rate due to cardiac rupture. Moreover, IL-33-treated MI mice displayed a significant myocardial eosinophil infiltration at 7 days post-MI when compared with vehicle-treated MI mice.

  • The present study reveals that although IL-33 administration is associated with a reparative phenotype following MI, it worsens cardiac remodeling and promotes heart failure.

  • Designing monoclonal antibodies targeting extracellularly released cytokines and their corresponding receptors has been a great tool in revolutionizing drug therapy in a wide range of disease areas [90]. Since the discovery of IL-33 over a decade ago, it became well established that this cytokine participates in tissue homeostasis but can induce highly detrimental effects when activated inappropriately. Hence, several mechanisms have been developed to harness the activity and bioavailability of this versatile cytokine on multiple levels. Soluble receptor blockers of free IL-33 including the IL-33Trap and a form of the sST2 receptor have been developed to antagonize the unwanted biological functions mediated by IL-33 both in vitro and in vivo [91–93]. In allergic conditions involving hyperreactive immune responses, such as allergic asthma and atopic dermatitis, IL-33 is a disease sensitizer and mediates detrimental functions [15]. The use of recombinant sST2 or antibodies targeting IL-33 or ST2 to block the signaling of the IL-33/ST2 axis have proven beneficial outcomes in the management of allergic asthma and atopic dermatitis [94–98]. However, in a multitude of other processes, the IL-33/ST2 signaling pathway has pleiotropic immune functions and operates like a double-edged sword, presenting both tissue-reparative and pathological properties in many organs of the body. For instance, in the kidneys, lungs, skin, gastrointestinal system, central nervous system, and cardiovascular system, IL-33 mediates both inflammatory and reparative responses [15,99]. In addition, the IL-33/ST2 axis is implicated in several diseases, including colitis, fibrosis, lupus, rheumatoid arthritis, multiple sclerosis, central nervous system disorders, and age-related macular degeneration [100]. Given the diverse roles of IL-33 in tissue injury and repair, determining the appropriate time to manipulate the IL-33/ST2 axis can be a great challenge in alleviating inflammation. In MI, where the reparative process is associated with a great imbalance in immune responses, neither the physiological nor the pathological functions of IL-33 are fully elucidated and await further exploration. Hence, the potential use of an anti-IL-33 antibody or the exogenous use of IL-33 as therapeutic strategies for the treatment of MI without activating unwanted immune responses remains a challenge. It awaits deeper understanding of the pharmacological dynamics to determine the ideal timing, route, and dosages in cardiac disease models.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the American University of Beirut Faculty of Medicine [MPP – 320145 (to F.A.Z.)]; the British Heart Foundation [grant numbers CH/10/001/27642 (to Z.M.), 1659].

Author Contribution

F.A.Z. and Z.M. contributed to the study design and conception. R.G., N.J.H., A.K., C.T., E.A., A.B., R.F., H.I., A.J., G.W.B., Z.M., and F.A.Z. participated in the acquisition, analysis or interpretation of the data. R.G. performed and supervised all the experiments. F.A.Z. and R.G. drafted the manuscript. All authors judiciously revised the manuscript and gave their final approval for all the data presented, ensuring reliability and integrity.

Acknowledgements

The authors thank Mr. Ali Mroueh for helping with the IL-33 ELISA and TUNEL assay and Miss Maria Esmerian for flow data acquisition.

Abbreviations

     
  • ANOVA

    analysis of variance

  •  
  • CO

    cardiac output

  •  
  • CSA

    cross-sectional area

  •  
  • CTGF

    connective tissue growth factor

  •  
  • DAPI

    4,6-diamino-2-phenylindole

  •  
  • ECM

    extracellular matrix

  •  
  • EF

    ejection fraction

  •  
  • ELISA

    enzyme-linked immunosorbent assay

  •  
  • FS

    fractional shortening

  •  
  • FSC

    forward scatter

  •  
  • IL

    interleukin

  •  
  • ILC2

    type 2 innate lymphoid cell

  •  
  • i.p.

    intraperitoneally

  •  
  • LAD

    left anterior descending

  •  
  • LV

    left ventricle

  •  
  • LVEDD

    LV end-diastolic diameter

  •  
  • LVEDV

    LV end-diastolic volume

  •  
  • LVESD

    LV end-systolic diameter

  •  
  • LVESV

    LV end-systolic volume

  •  
  • MI

    myocardial infarction

  •  
  • MMP

    matrix metalloproteinase

  •  
  • MTC

    Masson’s Trichrome

  •  
  • NF-κB

    nuclear factor-κB

  •  
  • PI3K

    phosphoinositide 3-kinase

  •  
  • RIPA

    Radioimmunoprecipitation assay

  •  
  • RNA

    ribonucleic acid

  •  
  • RT-qPCR

    reverse transcription quantitative polymerase chain reaction

  •  
  • SSC

    side scatter

  •  
  • ST2

    serum stimulation 2

  •  
  • ST2L

    long or transmembrane isoform of ST2

  •  
  • sST2

    soluble ST2

  •  
  • TBST

    Tris-buffered saline-Tween

  •  
  • TGF-β

    transforming growth factor β

  •  
  • Th2

    helper T cell

  •  
  • TNF-α

    tumor necrosis factor-α

  •  
  • TTC

    2,3,5 triphenyltetrazolium chloride

  •  
  • TUNEL

    terminal deoxynucleotidyl transferase dUTP nick-end labeling

  •  
  • α-SMA

    α smooth muscle actin

References

References
1.
Krum
H.
and
Teerlink
J.R.
(
2011
)
Medical therapy for chronic heart failure
.
Lancet
378
,
713
721
[PubMed]
2.
Prabhu
S.D.
and
Frangogiannis
N.G.
(
2016
)
The biological basis for cardiac repair after myocardial infarction: from inflammation to fibrosis
.
Circ. Res.
119
,
91
112
[PubMed]
3.
Altara
R.
,
Manca
M.
,
Sabra
R.
,
Eid
A.A.
,
Booz
G.W.
and
Zouein
F.A.
(
2015
)
Temporal cardiac remodeling post-myocardial infarction: dynamics and prognostic implications in personalized medicine
.
Heart Fail. Rev.
,
21
,
25
47
4.
Schmitz
J.
,
Owyang
A.
,
Oldham
E.
,
Song
Y.
,
Murphy
E.
,
McClanahan
T.K.
et al.
(
2005
)
IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines
.
Immunity
23
,
479
490
[PubMed]
5.
Baekkevold
E.S.
,
Roussigne
M.
,
Yamanaka
T.
,
Johansen
F.E.
,
Jahnsen
F.L.
,
Amalric
F.
et al.
(
2003
)
Molecular characterization of NF-HEV, a nuclear factor preferentially expressed in human high endothelial venules
.
Am. J. Pathol.
163
,
69
79
[PubMed]
6.
Li
J.
,
Razumilava
N.
,
Gores
G.J.
,
Walters
S.
,
Mizuochi
T.
,
Mourya
R.
et al.
(
2014
)
Biliary repair and carcinogenesis are mediated by IL-33-dependent cholangiocyte proliferation
.
J. Clin. Invest.
124
,
3241
3251
[PubMed]
7.
Bergers
G.
,
Reikerstorfer
A.
,
Braselmann
S.
,
Graninger
P.
and
Busslinger
M.
(
1994
)
Alternative promoter usage of the Fos-responsive gene Fit-1 generates mRNA isoforms coding for either secreted or membrane-bound proteins related to the IL-1 receptor
.
EMBO J.
13
,
1176
1188
[PubMed]
8.
Altara
R.
,
Ghali
R.
,
Mallat
Z.
,
Cataliotti
A.
,
Booz
G.W.
and
Zouein
F.A.
(
2018
)
Conflicting vascular and metabolic impact of the IL-33/sST2 axis
.
Cardiovasc. Res.
114
,
1578
1594
[PubMed]
9.
Ghali
R.
,
Altara
R.
,
Louch
W.E.
,
Cataliotti
A.
,
Mallat
Z.
,
Kaplan
A.
et al.
(
2018
)
IL-33 (interleukin 33)/sST2 (soluble suppression of tumorigenicity 2) axis in hypertension and heart failure
.
Hypertension
72
,
818
828
[PubMed]
10.
Moritz
D.R.
,
Rodewald
H.R.
,
Gheyselinck
J.
and
Klemenz
R.
(
1998
)
The IL-1 receptor-related T1 antigen is expressed on immature and mature mast cells and on fetal blood mast cell progenitors
.
J. Immunol.
161
,
4866
4874
[PubMed]
11.
Tare
N.
,
Li
H.
,
Morschauser
A.
,
Cote-Sierra
J.
,
Ju
G.
,
Renzetti
L.
et al.
(
2010
)
KU812 cells provide a novel in vitro model of the human IL-33/ST2L axis: functional responses and identification of signaling pathways
.
Exp. Cell Res.
316
,
2527
2537
[PubMed]
12.
Minutti
C.M.
,
Drube
S.
,
Blair
N.
,
Schwartz
C.
,
McCrae
J.C.
,
McKenzie
A.N.
et al.
(
2017
)
Epidermal growth factor receptor expression licenses type-2 helper T cells to function in a T cell receptor-independent fashion
.
Immunity
47
,
710e6
722e6
13.
Wang
M.
,
Shen
G.
,
Xu
L.
,
Liu
X.
,
Brown
J.M.
,
Feng
D.
et al.
(
2017
)
IL-1 receptor like 1 protects against alcoholic liver injury by limiting NF-kappaB activation in hepatic macrophages
.
J. Hepatol.
17
,
14.
Monticelli
L.A.
,
Sonnenberg
G.F.
,
Abt
M.C.
,
Alenghat
T.
,
Ziegler
C.G.
,
Doering
T.A.
et al.
(
2011
)
Innate lymphoid cells promote lung-tissue homeostasis after infection with influenza virus
.
Nat. Immunol.
12
,
1045
1054
[PubMed]
15.
Liew
F.Y.
,
Pitman
N.I.
and
McInnes
I.B.
(
2010
)
Disease-associated functions of IL-33: the new kid in the IL-1 family
.
Nat. Rev. Immunol.
10
,
103
110
[PubMed]
16.
Dyer
K.D.
,
Percopo
C.M.
and
Rosenberg
H.F.
(
2013
)
IL-33 promotes eosinophilia in vivo and antagonizes IL-5-dependent eosinophil hematopoiesis ex vivo
.
Immunol. Lett.
150
,
41
47
[PubMed]
17.
Hayakawa
H.
,
Hayakawa
M.
,
Kume
A.
and
Tominaga
S.
(
2007
)
Soluble ST2 blocks interleukin-33 signaling in allergic airway inflammation
.
J. Biol. Chem.
282
,
26369
26380
[PubMed]
18.
Sabatine
M.S.
,
Morrow
D.A.
,
Higgins
L.J.
,
MacGillivray
C.
,
Guo
W.
,
Bode
C.
et al.
(
2008
)
Complementary roles for biomarkers of biomechanical strain ST2 and N-terminal prohormone B-type natriuretic peptide in patients with ST-elevation myocardial infarction
.
Circulation
117
,
1936
1944
[PubMed]
19.
Shimpo
M.
,
Morrow
D.A.
,
Weinberg
E.O.
,
Sabatine
M.S.
,
Murphy
S.A.
,
Antman
E.M.
et al.
(
2004
)
Serum levels of the interleukin-1 receptor family member ST2 predict mortality and clinical outcome in acute myocardial infarction
.
Circulation
109
,
2186
2190
[PubMed]
20.
Ghali
R.
,
Altara
R.
,
Louch
W.E.
,
Cataliotti
A.
,
Mallat
Z.
,
Kaplan
A.
et al.
(
2018
)
IL-33 (Interleukin 33)/sST2 axis in hypertension and heart failure
.
Hypertension
72
,
818
828
[PubMed]
21.
Kurowska-Stolarska
M.
,
Hueber
A.
,
Stolarski
B.
and
McInnes
I.B.
(
2011
)
Interleukin-33: a novel mediator with a role in distinct disease pathologies
.
J. Intern. Med.
269
,
29
35
[PubMed]
22.
Benezech
C.
and
Jackson-Jones
L.H.
(
2019
)
ILC2 orchestration of local immune function in adipose tissue
.
Front. Immunol.
10
,
171
[PubMed]
23.
McHedlidze
T.
,
Waldner
M.
,
Zopf
S.
,
Walker
J.
,
Rankin
A.L.
,
Schuchmann
M.
et al.
(
2013
)
Interleukin-33-dependent innate lymphoid cells mediate hepatic fibrosis
.
Immunity
39
,
357
371
[PubMed]
24.
Brestoff
J.R.
,
Kim
B.S.
,
Saenz
S.A.
,
Stine
R.R.
,
Monticelli
L.A.
,
Sonnenberg
G.F.
et al.
(
2015
)
Group 2 innate lymphoid cells promote beiging of white adipose tissue and limit obesity
.
Nature
519
,
242
246
[PubMed]
25.
Price
A.E.
,
Liang
H.E.
,
Sullivan
B.M.
,
Reinhardt
R.L.
,
Eisley
C.J.
,
Erle
D.J.
et al.
(
2010
)
Systemically dispersed innate IL-13-expressing cells in type 2 immunity
.
Proc. Natl. Acad. Sci. U.S.A.
107
,
11489
11494
[PubMed]
26.
Neill
D.R.
,
Wong
S.H.
,
Bellosi
A.
,
Flynn
R.J.
,
Daly
M.
,
Langford
T.K.
et al.
(
2010
)
Nuocytes represent a new innate effector leukocyte that mediates type-2 immunity
.
Nature
464
,
1367
1370
[PubMed]
27.
Moro
K.
,
Yamada
T.
,
Tanabe
M.
,
Takeuchi
T.
,
Ikawa
T.
,
Kawamoto
H.
et al.
(
2010
)
Innate production of T(H)2 cytokines by adipose tissue-associated c-Kit(+)Sca-1(+) lymphoid cells
.
Nature
463
,
540
544
[PubMed]
28.
Nussbaum
J.C.
,
Van Dyken
S.J.
,
von Moltke
J.
,
Cheng
L.E.
,
Mohapatra
A.
,
Molofsky
A.B.
et al.
(
2013
)
Type 2 innate lymphoid cells control eosinophil homeostasis
.
Nature
502
,
245
248
[PubMed]
29.
Bracamonte-Baran
W.
,
Chen
G.
,
Hou
X.
,
Talor
M.V.
,
Choi
H.S.
,
Davogustto
G.
et al.
(
2019
)
Non-cytotoxic cardiac innate lymphoid cells are a resident and quiescent type 2-commited population
.
Front. Immunol.
10
,
634
[PubMed]
30.
Choi
H.S.
,
Won
T.
,
Hou
X.
,
Chen
G.
,
Bracamonte-Baran
W.
,
Talor
M.V.
et al.
(
2020
)
Innate lymphoid cells play a pathogenic role in pericarditis
.
Cell Rep.
30
,
2989e6
3003e6
31.
Veeraveedu
P.T.
,
Sanada
S.
,
Okuda
K.
,
Fu
H.Y.
,
Matsuzaki
T.
,
Araki
R.
et al.
(
2017
)
Ablation IL-33 gene exacerbate myocardial remodeling in mice with heart failure induced by mechanical stress
.
Biochem. Pharmacol.
138
,
[PubMed]
32.
Sanada
S.
,
Hakuno
D.
,
Higgins
L.J.
,
Schreiter
E.R.
,
McKenzie
A.N.
and
Lee
R.T.
(
2007
)
IL-33 and ST2 comprise a critical biomechanically induced and cardioprotective signaling system
.
J. Clin. Invest.
117
,
1538
1549
[PubMed]
33.
Li
J.
,
Xia
N.
,
Wen
S.
,
Li
D.
,
Lu
Y.
,
Gu
M.
et al.
(
2019
)
IL (Interleukin)-33 suppresses abdominal aortic aneurysm by enhancing regulatory T-cell expansion and activity
.
Arterioscler. Thromb. Vasc. Biol.
39
,
34.
McLaren
J.E.
,
Michael
D.R.
,
Salter
R.C.
,
Ashlin
T.G.
,
Calder
C.J.
,
Miller
A.M.
et al.
(
2010
)
IL-33 reduces macrophage foam cell formation
.
J. Immunol.
185
,
1222
1229
[PubMed]
35.
Miller
A.M.
,
Xu
D.
,
Asquith
D.L.
,
Denby
L.
,
Li
Y.
,
Sattar
N.
et al.
(
2008
)
IL-33 reduces the development of atherosclerosis
.
J. Exp. Med.
205
,
339
346
[PubMed]
36.
Li
J.
,
Shen
D.
,
Tang
J.
,
Wang
Y.
,
Wang
B.
,
Xiao
Y.
et al.
(
2019
)
IL33 attenuates ventricular remodeling after myocardial infarction through inducing alternatively activated macrophages ethical standards statement
.
Eur. J. Pharmacol.
854
,
37.
Yin
H.
,
Li
P.
,
Hu
F.
,
Wang
Y.
,
Chai
X.
and
Zhang
Y.
(
2014
)
IL-33 attenuates cardiac remodeling following myocardial infarction via inhibition of the p38 MAPK and NF-kappaB pathways
.
Mol. Med. Rep.
9
,
1834
1838
[PubMed]
38.
Seki
K.
,
Sanada
S.
,
Kudinova
A.Y.
,
Steinhauser
M.L.
,
Handa
V.
,
Gannon
J.
et al.
(
2009
)
Interleukin-33 prevents apoptosis and improves survival after experimental myocardial infarction through ST2 signaling
.
Circ. Heart Fail.
2
,
684
691
[PubMed]
39.
Martin
P.
,
Palmer
G.
,
Rodriguez
E.
,
Woldt
E.
,
Mean
I.
,
James
R.W.
et al.
(
2015
)
Atherosclerosis severity is not affected by a deficiency in IL-33/ST2 signaling
.
Immun. Inflamm. Dis.
3
,
239
246
[PubMed]
40.
Tseng
C.C.S.
,
Huibers
M.M.H.
,
van Kuik
J.
,
de Weger
R.A.
,
Vink
A.
and
de Jonge
N.
(
2018
)
The interleukin-33/ST2 pathway is expressed in the failing human heart and associated with pro-fibrotic remodeling of the myocardium
.
J. Cardiovasc. Transl. Res.
11
,
15
21
[PubMed]
41.
Abston
E.D.
,
Barin
J.G.
,
Cihakova
D.
,
Bucek
A.
,
Coronado
M.J.
,
Brandt
J.E.
et al.
(
2012
)
IL-33 independently induces eosinophilic pericarditis and cardiac dilation: ST2 improves cardiac function
.
Circ. Heart Fail.
5
,
366
375
[PubMed]
42.
Tarnavski
O.
,
McMullen
J.R.
,
Schinke
M.
,
Nie
Q.
,
Kong
S.
and
Izumo
S.
(
2004
)
Mouse cardiac surgery: comprehensive techniques for the generation of mouse models of human diseases and their application for genomic studies
.
Physiol. Genomics
16
,
349
360
[PubMed]
43.
Nie
X.
,
Li
C.
,
Hu
S.
,
Xue
F.
,
Kang
Y.J.
and
Zhang
W.
(
2017
)
An appropriate loading control for western blot analysis in animal models of myocardial ischemic infarction
.
Biochem. Biophys. Rep.
12
,
108
113
[PubMed]
44.
Zouggari
Y.
,
Ait-Oufella
H.
,
Bonnin
P.
,
Simon
T.
,
Sage
A.P.
,
Guerin
C.
et al.
(
2013
)
B lymphocytes trigger monocyte mobilization and impair heart function after acute myocardial infarction
.
Nat. Med.
19
,
1273
1280
[PubMed]
45.
Howangyin
K.Y.
,
Zlatanova
I.
,
Pinto
C.
,
Ngkelo
A.
,
Cochain
C.
,
Rouanet
M.
et al.
(
2016
)
Myeloid-epithelial-reproductive receptor tyrosine kinase and milk fat globule epidermal growth factor 8 coordinately improve remodeling after myocardial infarction via local delivery of vascular endothelial growth factor
.
Circulation
133
,
826
839
[PubMed]
46.
Newland
S.A.
,
Mohanta
S.
,
Clement
M.
,
Taleb
S.
,
Walker
J.A.
,
Nus
M.
et al.
(
2017
)
Type-2 innate lymphoid cells control the development of atherosclerosis in mice
.
Nat. Commun.
8
,
15781
[PubMed]
47.
Johnston
L.K.
and
Bryce
P.J.
(
2017
)
Understanding interleukin 33 and its roles in eosinophil development
.
Front Med. (Lausanne)
4
,
51
[PubMed]
48.
Brunner
S.M.
,
Schiechl
G.
,
Falk
W.
,
Schlitt
H.J.
,
Geissler
E.K.
and
Fichtner-Feigl
S.
(
2011
)
Interleukin-33 prolongs allograft survival during chronic cardiac rejection
.
Transpl. Int.
24
,
1027
1039
[PubMed]
49.
Hardman
C.
and
Ogg
G.
(
2016
)
Interleukin-33, friend and foe in type-2 immune responses
.
Curr. Opin. Immunol.
42
,
16
24
[PubMed]
50.
Chen
W.
and
Frangogiannis
N.G.
(
2013
)
Fibroblasts in post-infarction inflammation and cardiac repair
.
Biochim. Biophys. Acta
1833
,
945
953
[PubMed]
51.
Spinale
F.G.
,
Janicki
J.S.
and
Zile
M.R.
(
2013
)
Membrane-associated matrix proteolysis and heart failure
.
Circ. Res.
112
,
195
208
[PubMed]
52.
Ducharme
A.
,
Frantz
S.
,
Aikawa
M.
,
Rabkin
E.
,
Lindsey
M.
,
Rohde
L.E.
et al.
(
2000
)
Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction
.
J. Clin. Invest.
106
,
55
62
[PubMed]
53.
Heymans
S.
,
Luttun
A.
,
Nuyens
D.
,
Theilmeier
G.
,
Creemers
E.
,
Moons
L.
et al.
(
1999
)
Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure
.
Nat. Med.
5
,
1135
1142
[PubMed]
54.
Matsumura
S.
,
Iwanaga
S.
,
Mochizuki
S.
,
Okamoto
H.
,
Ogawa
S.
and
Okada
Y.
(
2005
)
Targeted deletion or pharmacological inhibition of MMP-2 prevents cardiac rupture after myocardial infarction in mice
.
J. Clin. Invest.
115
,
599
609
[PubMed]
55.
Schwingshackl
A.
,
Duszyk
M.
,
Brown
N.
and
Moqbel
R.
(
1999
)
Human eosinophils release matrix metalloproteinase-9 on stimulation with TNF-alpha
.
J. Allergy Clin. Immunol.
104
,
983
989
[PubMed]
56.
Kuwabara
Y.
,
Kobayashi
T.
,
D'Alessandro-Gabazza
C.N.
,
Toda
M.
,
Yasuma
T.
,
Nishihama
K.
et al.
(
2018
)
Role of matrix metalloproteinase-2 in eosinophil-mediated airway remodeling
.
Front. Immunol.
9
,
2163
[PubMed]
57.
Kato
A.
(
2019
)
Group 2 innate lymphoid cells in airway diseases
.
Chest
156
,
141
149
[PubMed]
58.
Gauvreau
G.M.
,
White
L.
and
Davis
B.E.
(
2020
)
Anti-alarmin approaches entering clinical trials
.
Curr. Opin. Pulm. Med.
26
,
59.
Bouffi
C.
,
Rochman
M.
,
Zust
C.B.
,
Stucke
E.M.
,
Kartashov
A.
,
Fulkerson
P.C.
et al.
(
2013
)
IL-33 markedly activates murine eosinophils by an NF-kappaB-dependent mechanism differentially dependent upon an IL-4-driven autoinflammatory loop
.
J. Immunol.
191
,
4317
4325
[PubMed]
60.
Cherry
W.B.
,
Yoon
J.
,
Bartemes
K.R.
,
Iijima
K.
and
Kita
H.
(
2008
)
A novel IL-1 family cytokine, IL-33, potently activates human eosinophils
.
J. Allergy Clin. Immunol.
121
,
1484
1490
[PubMed]
61.
Esnault
S.
and
Kelly
E.A.
(
2016
)
Essential mechanisms of differential activation of eosinophils by IL-3 compared to GM-CSF and IL-5
.
Crit. Rev. Immunol.
36
,
429
444
[PubMed]
62.
Diny
N.L.
,
Hou
X.
,
Barin
J.G.
,
Chen
G.
,
Talor
M.V.
,
Schaub
J.
et al.
(
2016
)
Macrophages and cardiac fibroblasts are the main producers of eotaxins and regulate eosinophil trafficking to the heart
.
Eur. J. Immunol.
46
,
2749
2760
[PubMed]
63.
Anzai
A.
,
Choi
J.L.
,
He
S.
,
Fenn
A.M.
,
Nairz
M.
,
Rattik
S.
et al.
(
2017
)
The infarcted myocardium solicits GM-CSF for the detrimental oversupply of inflammatory leukocytes
.
J. Exp. Med.
214
,
3293
3310
[PubMed]
64.
Hallgren
R.
,
Venge
P.
,
Cullhed
I.
and
Olsson
I.
(
1979
)
Blood eosinophils and eosinophil cationic protein after acute myocardial infarction or corticosteroid administration
.
Br. J. Haematol.
42
,
147
154
[PubMed]
65.
Atkinson
J.B.
,
Robinowitz
M.
,
McAllister
H.A.
and
Virmani
R.
(
1985
)
Association of eosinophils with cardiac rupture
.
Hum. Pathol.
16
,
562
568
[PubMed]
66.
Jiang
P.
,
Wang
D.Z.
,
Ren
Y.L.
,
Cai
J.P.
and
Chen
B.X.
(
2015
)
Significance of eosinophil accumulation in the thrombus and decrease in peripheral blood in patients with acute coronary syndrome
.
Coron. Artery Dis.
26
,
101
106
[PubMed]
67.
Odeberg
J.
,
Freitag
M.
,
Forssell
H.
,
Vaara
I.
,
Persson
M.L.
,
Odeberg
H.
et al.
(
2016
)
Influence of pre- existing inflammation on the outcome of acute coronary syndrome: a cross-sectional study
.
BMJ Open
6
,
e009968
[PubMed]
68.
Rios-Navarro
C.
,
Gavara
J.
,
Vidal
V.
,
Bonanad
C.
,
Racugno
P.
,
Bayes-Genis
A.
et al.
(
2018
)
Characterization and implications of the dynamics of eosinophils in blood and in the infarcted myocardium after coronary reperfusion
.
PLoS ONE
13
,
e0206344
[PubMed]
69.
Niccoli
G.
,
Schiavino
D.
,
Belloni
F.
,
Ferrante
G.
,
La Torre
G.
,
Conte
M.
et al.
(
2009
)
Pre-intervention eosinophil cationic protein serum levels predict clinical outcomes following implantation of drug-eluting stents
.
Eur. Heart J.
30
,
1340
1347
[PubMed]
70.
Niccoli
G.
,
Sgueglia
G.A.
,
Conte
M.
,
Cosentino
N.
,
Minelli
S.
,
Belloni
F.
et al.
(
2011
)
Eosinophil cationic protein and clinical outcome after bare metal stent implantation
.
Atherosclerosis
215
,
166
169
[PubMed]
71.
Niccoli
G.
,
Calvieri
C.
,
Flego
D.
,
Scalone
G.
,
Imaeva
A.
,
Sabato
V.
et al.
(
2015
)
Allergic inflammation is associated with coronary instability and a worse clinical outcome after acute myocardial infarction
.
Circ. Cardiovasc. Interv.
8
,
e002554
[PubMed]
72.
Shiyovich
A.
,
Gilutz
H.
and
Plakht
Y.
(
2017
)
White blood cell subtypes are associated with a greater long-term risk of death after acute myocardial infarction
.
Tex. Heart Inst. J.
44
,
176
188
[PubMed]
73.
Weinberg
E.O.
,
Shimpo
M.
,
De Keulenaer
G.W.
,
MacGillivray
C.
,
Tominaga
S.
,
Solomon
S.D.
et al.
(
2002
)
Expression and regulation of ST2, an interleukin-1 receptor family member, in cardiomyocytes and myocardial infarction
.
Circulation
106
,
2961
2966
[PubMed]
74.
Anand
I.S.
,
Rector
T.S.
,
Kuskowski
M.
,
Snider
J.
and
Cohn
J.N.
(
2014
)
Prognostic value of soluble ST2 in the Valsartan Heart Failure Trial
.
Circ. Heart Fail.
7
,
418
426
[PubMed]
75.
Felker
G.M.
,
Fiuzat
M.
,
Thompson
V.
,
Shaw
L.K.
,
Neely
M.L.
,
Adams
K.F.
et al.
(
2013
)
Soluble ST2 in ambulatory patients with heart failure: association with functional capacity and long-term outcomes
.
Circ. Heart Fail.
6
,
1172
1179
[PubMed]
76.
Lefrancais
E.
and
Cayrol
C.
(
2012
)
Mechanisms of IL-33 processing and secretion: differences and similarities between IL-1 family members
.
Eur. Cytokine Netw.
23
,
120
127
[PubMed]
77.
Yan
X.
,
Anzai
A.
,
Katsumata
Y.
,
Matsuhashi
T.
,
Ito
K.
,
Endo
J.
et al.
(
2013
)
Temporal dynamics of cardiac immune cell accumulation following acute myocardial infarction
.
J. Mol. Cell. Cardiol.
62
,
24
35
[PubMed]
78.
Kakkar
R.
and
Lee
R.T.
(
2008
)
The IL-33/ST2 pathway: therapeutic target and novel biomarker
.
Nat. Rev. Drug Discov.
7
,
827
840
[PubMed]
79.
Brint
E.K.
,
Fitzgerald
K.A.
,
Smith
P.
,
Coyle
A.J.
,
Gutierrez-Ramos
J.C.
,
Fallon
P.G.
et al.
(
2002
)
Characterization of signaling pathways activated by the interleukin 1 (IL-1) receptor homologue T1/ST2. A role for Jun N-terminal kinase in IL-4 induction
.
J. Biol. Chem.
277
,
49205
49211
[PubMed]
80.
Funakoshi-Tago
M.
,
Tago
K.
,
Hayakawa
M.
,
Tominaga
S.
,
Ohshio
T.
,
Sonoda
Y.
et al.
(
2008
)
TRAF6 is a critical signal transducer in IL-33 signaling pathway
.
Cell. Signal.
20
,
1679
1686
[PubMed]
81.
Funakoshi-Tago
M.
,
Tago
K.
,
Sato
Y.
,
Tominaga
S.
and
Kasahara
T.
(
2011
)
JAK2 is an important signal transducer in IL-33-induced NF-kappaB activation
.
Cell. Signal.
23
,
363
370
[PubMed]
82.
Choi
Y.S.
,
Choi
H.J.
,
Min
J.K.
,
Pyun
B.J.
,
Maeng
Y.S.
,
Park
H.
et al.
(
2009
)
Interleukin-33 induces angiogenesis and vascular permeability through ST2/TRAF6-mediated endothelial nitric oxide production
.
Blood
114
,
3117
3126
[PubMed]
83.
Yagami
A.
,
Orihara
K.
,
Morita
H.
,
Futamura
K.
,
Hashimoto
N.
,
Matsumoto
K.
et al.
(
2010
)
IL-33 mediates inflammatory responses in human lung tissue cells
.
J. Immunol.
185
,
5743
5750
[PubMed]
84.
Bilancio
A.
,
Rinaldi
B.
,
Oliviero
M.A.
,
Donniacuo
M.
,
Monti
M.G.
,
Boscaino
A.
et al.
(
2017
)
Inhibition of p110delta PI3K prevents inflammatory response and restenosis after artery injury
.
Biosci. Rep.
37
,
[PubMed]
85.
Smirnova
N.F.
,
Gayral
S.
,
Pedros
C.
,
Loirand
G.
,
Vaillant
N.
,
Malet
N.
et al.
(
2014
)
Targeting PI3Kgamma activity decreases vascular trauma-induced intimal hyperplasia through modulation of the Th1 response
.
J. Exp. Med.
211
,
1779
1792
[PubMed]
86.
Bilancio
A.
and
Migliaccio
A.
(
2014
)
Phosphoinositide 3-kinase assay in breast cancer cell extracts
.
Methods Mol. Biol.
1204
,
145
153
[PubMed]
87.
Young
L.H.
,
Ikeda
Y.
,
Scalia
R.
and
Lefer
A.M.
(
2000
)
Wortmannin, a potent antineutrophil agent, exerts cardioprotective effects in myocardial ischemia/reperfusion
.
J. Pharmacol. Exp. Ther.
295
,
37
43
[PubMed]
88.
Doukas
J.
,
Wrasidlo
W.
,
Noronha
G.
,
Dneprovskaia
E.
,
Fine
R.
,
Weis
S.
et al.
(
2006
)
Phosphoinositide 3-kinase gamma/delta inhibition limits infarct size after myocardial ischemia/reperfusion injury
.
Proc. Natl. Acad. Sci. U.S.A.
103
,
19866
19871
[PubMed]
89.
Palframan
R.T.
,
Collins
P.D.
,
Severs
N.J.
,
Rothery
S.
,
Williams
T.J.
and
Rankin
S.M.
(
1998
)
Mechanisms of acute eosinophil mobilization from the bone marrow stimulated by interleukin 5: the role of specific adhesion molecules and phosphatidylinositol 3-kinase
.
J. Exp. Med.
188
,
1621
1632
[PubMed]
90.
Buss
N.A.
,
Henderson
S.J.
,
McFarlane
M.
,
Shenton
J.M.
and
de Haan
L.
(
2012
)
Monoclonal antibody therapeutics: history and future
.
Curr. Opin. Pharmacol.
12
,
615
622
[PubMed]
91.
Holgado
A.
,
Braun
H.
,
Van Nuffel
E.
,
Detry
S.
,
Schuijs
M.J.
,
Deswarte
K.
et al.
(
2019
)
IL-33trap is a novel IL-33-neutralizing biologic that inhibits allergic airway inflammation
.
J. Allergy Clin. Immunol.
144
,
204
215
[PubMed]
92.
Arshad
M.I.
,
Khan
H.A.
,
Noel
G.
,
Piquet-Pellorce
C.
and
Samson
M.
(
2016
)
Potential therapeutic aspects of alarmin cytokine interleukin 33 or its inhibitors in various diseases
.
Clin. Ther.
38
,
1000
1016.e1
93.
Xi
H.
,
Katschke
K.J.
Jr
,
Li
Y.
,
Truong
T.
,
Lee
W.P.
,
Diehl
L.
et al.
(
2016
)
IL-33 amplifies an innate immune response in the degenerating retina
.
J. Exp. Med.
213
,
189
207
[PubMed]
94.
Lei
Y.
,
Boinapally
V.
,
Zoltowska
A.
,
Adner
M.
,
Hellman
L.
and
Nilsson
G.
(
2015
)
Vaccination against IL-33 inhibits airway hyperresponsiveness and inflammation in a house dust mite model of asthma
.
PLoS ONE
10
,
e0133774
[PubMed]
95.
Liu
X.
,
Li
M.
,
Wu
Y.
,
Zhou
Y.
,
Zeng
L.
and
Huang
T.
(
2009
)
Anti-IL-33 antibody treatment inhibits airway inflammation in a murine model of allergic asthma
.
Biochem. Biophys. Res. Commun.
386
,
181
185
[PubMed]
96.
Mizutani
N.
,
Nabe
T.
and
Yoshino
S.
(
2013
)
Interleukin-33 and alveolar macrophages contribute to the mechanisms underlying the exacerbation of IgE-mediated airway inflammation and remodelling in mice
.
Immunology
139
,
205
218
[PubMed]
97.
Kim
Y.H.
,
Yang
T.Y.
,
Park
C.S.
,
Ahn
S.H.
,
Son
B.K.
,
Kim
J.H.
et al.
(
2012
)
Anti-IL-33 antibody has a therapeutic effect in a murine model of allergic rhinitis
.
Allergy
67
,
183
190
[PubMed]
98.
Peng
G.
,
Mu
Z.
,
Cui
L.
,
Liu
P.
,
Wang
Y.
,
Wu
W.
et al.
(
2018
)
Anti-IL-33 antibody has a therapeutic effect in an atopic dermatitis murine model induced by 2,4-Dinitrochlorobenzene
.
Inflammation
41
,
154
163
[PubMed]
99.
Chen
W.Y.
,
Tsai
T.H.
,
Yang
J.L.
and
Li
L.C.
(
2018
)
Therapeutic strategies for targeting IL-33/ST2 signalling for the treatment of inflammatory diseases
.
Cell. Physiol. Biochem.
49
,
349
358
[PubMed]
100.
Braun
H.
,
Afonina
I.S.
,
Mueller
C.
and
Beyaert
R.
(
2018
)
Dichotomous function of IL-33 in health and disease: from biology to clinical implications
.
Biochem. Pharmacol.
148
,
238
252
[PubMed]

Supplementary data