Abstract

Perivascular adipose tissue (PVAT) dysfunction is associated with vascular damage in cardiometabolic diseases. Although heart failure (HF)-induced endothelial dysfunction is associated with renin–angiotensin system (RAS) activation, no data have correlated this syndrome with PVAT dysfunction. Thus, the aim of the present study was to investigate whether the hyperactivation of the RAS in PVAT participates in the vascular dysfunction observed in rats with HF after myocardial infarction surgery. Wire myograph studies were carried out in thoracic aorta rings in the presence and absence of PVAT. An anticontractile effect of PVAT was observed in the rings of the control rats in the presence (33%) or absence (11%) of endothelium. Moreover, this response was substantially reduced in animals with HF (5%), and acute type 1 angiotensin II receptor (AT1R) and type 2 angiotensin II receptor (AT2R) blockade restored the anticontractile effect of PVAT. In addition, the angiotensin-converting enzyme 1 (ACE1) activity (26%) and angiotensin II levels (51%), as well as the AT1R and AT2R gene expression, were enhanced in the PVAT of rats with HF. Associated with these alterations, HF-induced lower nitric oxide bioavailability, oxidative stress and whitening of the PVAT, which suggests changes in the secretory function of this tissue. The ACE1/angiotensin II/AT1R and AT2R axes are involved in thoracic aorta PVAT dysfunction in rats with HF. These results suggest PVAT as a target in the pathophysiology of vascular dysfunction in HF and provide new perspectives for the treatment of this syndrome.

Introduction

Perivascular adipose tissue (PVAT) is an endocrine tissue that anatomically encompasses the majority of vessels; PVAT releases vasoactive substances that are capable of modify vascular tonus [1–3]. Soltis and Cassis [4] were the first authors to show the ability of PVAT to modulate the vascular contractile capacity; accordingly, PVAT was able to attenuate the vascular responsiveness of the aortic ring to norepinephrine. Later, this effect was confirmed by others who observed that the anticontractile effects of PVAT occurred in different regions independently of the contractile agonist in both rodent and human vascular tissues [1,3–6]. The anticontractile effect of PVAT, however, is impaired in the presence of cardiometabolic risk factors, such a condition defined as ‘PVAT dysfunction’ [2,7–9].

Interestingly, renin–angiotensin system (RAS) components are expressed in the PVAT of the aorta and mesenteric arteries of healthy rats [10], and angiotensin 1-7 is considered one putative vasodilator factor that is released from PVAT [11]. Furthermore, in adipose tissue, the RAS stimulates adipocyte growth and differentiation, interferes with lipid metabolism and adipokine expression/release, and promotes oxidative stress [12]. In addition, some studies have observed that alterations in RAS signaling through angiotensin II/type 1 angiotensin II receptor (AT1R) are involved in PVAT dysfunction [7], which may contribute to changes in vascular reactivity in the presence of cardiometabolic risk factors. Therefore, the specific role of the RAS in PVAT remains to be elucidated.

Previous studies have shown that the activation of the RAS is involved in the pathophysiology of several cardiovascular diseases [13,14], including heart failure (HF). In HF animal models and in patients, there is systemic RAS activation as a compensatory mechanism in response to the reduced cardiac output. Such activation was also described in the local RAS. Long-lasting systemic and local RAS activation produce specific tissue changes, such as endothelial dysfunction, oxidative stress and vascular inflammation [15–18]. Treatment of HF with angiotensin converting enzyme 1 (ACE1) inhibitors and AT1R antagonists normalizes the vascular dysfunction and inflammation [16,18,19] and prevents the progressive deterioration of cardiovascular function in rodents and humans.

Thus, considering that PVAT has a central role in the control of vascular tone and homeostasis, RAS components are expressed in PVAT, and the vascular dysfunction observed in HF is associated with RAS activation, the present study aims to investigate whether RAS overactivation in PVAT is pivotal to the vascular dysfunction observed in HF rats.

Materials and methods

Experimental model

All the experimental procedures were approved by the Animal Care and Use Committee of the Institute of Biomedical Sciences of the University of Sao Paulo (No. 53, sheet 19, book 03) and were conducted in accordance with the Brazilian Council of Animal Research (CONCEA). Male Wistar rats (230–280 g) were obtained from colonies maintained at the Animal House of the Institute of Biomedical Sciences of the University of Sao Paulo. The rats were housed at a constant room temperature and humidity with a 12:12-h light–dark cycle and free access to standard rat chow and tap water. The experimental procedures described below were performed at Dr Rossoni’s and Barreto-Chaves’s Laboratories at the Institute of Biomedical Sciences of the University of Sao Paulo.

Male Wistar rats were anesthetized (ketamine and xylazine, 90 and 10 mg/kg, respectively; i.p.; Sespo Indústria e Comércio, Paulínia, SP, Brazil) and subjected to myocardial infarction (MI) by permanent occlusion of the left coronary artery or to a sham operation (SO), as previously described [20]. The present study was performed in males, as female rats show less hemodynamic and cardiac adjustments and congestive signs after MI than male rats, despite of the same infarct area [21,22].

Hemodynamic and morphometric evaluations

Twelve weeks after the MI or SO surgery, the left ventricle hemodynamic parameters were measured in anesthetized animals (urethane, 1.2 g/kg, i.p.; Sigma-Aldrich, St. Louis, MO, U.S.A.) as previously published by our group [20].

Then, the rats were euthanized by exsanguination, and the heart, lungs, tibia and thoracic aorta (with PVAT) were carefully removed. The right and left ventricular hypertrophy index, the degree of pulmonary congestion and the infarct area were evaluated as previously described [20]. It is important to note that only rats with infarct areas covering 30–50% of the left ventricular surface were included in the present study, as previously published [23–25].

Vascular reactivity studies using wire myograph

The thoracic aortas were isolated, placed in Petri dishes with oxygenated ice-cold Krebs–Henseleit solution (KHS, in mM: 118 NaCl, 4.7 KCl, 25 NaHCO3, 2.5 CaCl2·2H2O, 1.2 KH2PO4, 1.2 MgSO4·7H2O, 11 glucose and 0.01 EDTA) at pH 7.4 and sectioned into 3-mm rings with or without (mechanical denuded) PVAT. In some experiments, the endothelial cells were also removed by gently rolling the vessel lumen with a needle. Then, two wires were introduced through the lumen of the thoracic aorta rings to allow the measurement of the isometric tension (Letica TRI 210, Barcelona, Spain). The arteries were mounted in a bath (5 ml KHS at 37°C) at a resting tension of 1.0 g, as previously described by our group [26].

The vascular reactivity of the thoracic aorta rings was assessed under four conditions: with endothelium and PVAT (E+/PVAT+), without endothelium and PVAT (E-/PVAT-), with endothelium and without PVAT (E+/PVAT-) and without endothelium and with PVAT (E-/PVAT+) (Figure 1A).

Vascular reactivity studies using wire myograph

Figure 1
Vascular reactivity studies using wire myograph

(A) The vascular reactivity of the thoracic aorta rings was assessed under four conditions: with endothelium and perivascular adipose tissue (E+/PVAT+), without endothelium and perivascular adipose tissue (E-/PVAT-), with endothelium and without perivascular adipose tissue (E+/PVAT-) and without endothelium and with perivascular adipose tissue (E-/PVAT+), in the absence or presence of the following antagonists or inhibitor: type 1 angiotensin II receptor (AT1R) antagonist (Losartan, 10 μmol/l), type 2 angiotensin II receptor (AT2R) antagonist (PD123319, 1 μmol/l) or nonselective nitric oxide synthase (NOS) inhibitor L-NAME (100 μmol/l). (B) Time-course of vascular reactivity experiments. Note that only one concentration-response curve to phenylephrine was performed in each thoracic aorta ring. KPSS, high-K+ solution; Phe, Phenylephrine; Ach, Acetylcholine. Figure was prepared using the BioRender program (biorender.com/).

Figure 1
Vascular reactivity studies using wire myograph

(A) The vascular reactivity of the thoracic aorta rings was assessed under four conditions: with endothelium and perivascular adipose tissue (E+/PVAT+), without endothelium and perivascular adipose tissue (E-/PVAT-), with endothelium and without perivascular adipose tissue (E+/PVAT-) and without endothelium and with perivascular adipose tissue (E-/PVAT+), in the absence or presence of the following antagonists or inhibitor: type 1 angiotensin II receptor (AT1R) antagonist (Losartan, 10 μmol/l), type 2 angiotensin II receptor (AT2R) antagonist (PD123319, 1 μmol/l) or nonselective nitric oxide synthase (NOS) inhibitor L-NAME (100 μmol/l). (B) Time-course of vascular reactivity experiments. Note that only one concentration-response curve to phenylephrine was performed in each thoracic aorta ring. KPSS, high-K+ solution; Phe, Phenylephrine; Ach, Acetylcholine. Figure was prepared using the BioRender program (biorender.com/).

To evaluate the maximal tension reached by each ring, after a 30 min equilibration period, the rings were exposed to a high-K+ solution (75 mmol/l). The maximal tension developed by the rings did not differ among the groups (MI vs. SO) and conditions (with or without endothelium and/or PVAT) [K+-induced contraction: rings with endothelium: SO E+/PVAT+: 8.30 ± 0.39 (n=28) vs. SO E+/PVAT-: 8.48 ± 0.44 (n=27) vs. MI E+/PVAT+: 9.02 ± 0.32 (n=36) vs. MI E+/PVAT-: 9.56 ± 0.55 (n=38) mN/mm; two-way ANOVA, P>0.05 and in rings without endothelium: SO E-/PVAT+: 8.78 ± 0.56 (n=22) vs. SO E-/PVAT-: 8.56 ± 0.23 (n=18) vs. MI E-/PVAT+: 9.55 ± 0.52 (n=26) vs. MI E-/PVAT-: 10.44 ± 0.53 (n=12) mN/mm; two-way ANOVA, P>0.05].

Subsequently, the endothelial integrity was evaluated by the acetylcholine (10 μmol/l; Sigma-Aldrich)-induced relaxation response in rings that were precontracted with the α1-adrenoceptor agonist phenylephrine (at a concentration that produces 50–70% of the maximal tension induced by the high-K+ solution, Sigma-Aldrich). The rings with acetylcholine-induced relaxation equal to or greater than 80% were considered to have functional endothelial integrity (E+), and the rings with acetylcholine-induced relaxation equal to or less than 10% were considered to have no functional endothelial integrity (E-).

After a washout period of 30 min, phenylephrine-induced concentration–response curves (0.1 ηmol/l to 300 μmol/l) were assessed in the absence or presence of the following antagonists or inhibitor: AT1R antagonist (Losartan, 10 μmol/l; Sigma-Aldrich), type 2 angiotensin II receptor (AT2R) antagonist (PD123319, 1 μmol/l; Sigma-Aldrich) or nonselective nitric oxide synthase (NOS) inhibitor L-NAME (100 μmol/l; Sigma-Aldrich). All the agents were added to the bath 30 min before the phenylephrine-induced concentration–response curve was generated. The antagonists or inhibitor did not change the basal resting tension among conditions and between groups. It is important to emphasize that only one concentration–response curve to phenylephrine was performed in each thoracic aorta ring (Figure 1B).

The phenylephrine-induced contractile response is presented in mN (data acquisition system, MP 100, Biopac Systems Inc., Goleta, CA, U.S.A.) and was normalized by the ring length (mN/mm). To compare the effects of different conditions (with endothelium and/or PVAT) and/or drug on the response to phenylephrine in the rings from both groups of rats, the maximum response (Emax values) and the negative log of the agonist concentrations producing 50% of maximum response (pD2 values) were estimated by an iterative nonlinear regression analysis of each individual concentration-response curve (Graph Pad Prism Software, San Diego, CA, U.S.A.).

At the end of the experiments, the PVAT was dissected and weighed on a precision scale (BEL Engineering, Piracicaba, SP, Brazil), and the weight is expressed as mg of PVAT/mm of ring length.

Histology

Some thoracic aorta rings with their respective PVAT from both groups were dissected, isolated and fixed in 4% buffered paraformaldehyde solution (Synth, Diadema, SP, Brazil) for 24 h and afterwards stored in 70% alcohol. Then, the rings were paraffined, and cross-section (5 μm thick) were made. Hematoxylin and eosin staining was performed, and the sections were visualized by light microscopy (Eclipse 80i, Nikon, Shinagawa, Tokyo, Japan) using a 40× objective.

Reactive oxygen species (ROS) evaluation

Three millimeter rings of the thoracic aortas with their respective PVAT were isolated from both groups in Petri dishes with oxygenated ice-cold KHS. Then, in a dark chamber, these rings were incubated for 30 min in oxygenated KHS (pH = 7.4, 37°C) with dihydroethidium (DHE, 2 μmol/l; Life Technologies, Carlsbad, CA, U.S.A.) for ROS measurement in situ, as previously described [27]. Subsequently, these thoracic aortas with PVAT rings were fixed in a 4% buffered paraformaldehyde solution (Synth) for 4 h and then embedded in freezing medium (Tissue-Tek, Sakura Finetek, Torrance, CA, U.S.A.). Transverse sections (10 μm thick) of frozen arteries with PVAT were equilibrated in phosphate buffer (0.1 mol/l, pH 7.4) for 10 min at 37°C, and images were obtained using an optical microscope (Eclipse 80i, Nikon) equipped with rhodamine filter, a camera (DS-U3, Nikon, Shinagawa, Tokyo, Japan) and a 20× objective. The images were analyzed using ImageJ software (NIH, Bethesda, MD, U.S.A.). The ROS production was evaluated and expressed as the integrated density of DHE fluorescence.

Angiotensin-converting enzyme (ACE) activity evaluation

For the ACE1 or ACE2 activity assays, the thoracic aortas with their respective PVAT were isolated in Petri dishes with oxygenated ice-cold KHS, and subsequently, the aortic tissues and their PVAT were quickly dissected, rinsed with oxygenated ice-cold KHS and independently frozen.

ACE1 activity assay

On the day of the assay, the aortic tissue and PVAT were homogenized in 0.4 M sodium borate buffer, pH 7.2. The homogenates were subsequently centrifuged (10,000 rpm for 15 min at 4°C). Then, the protocol was performed as previously described by Senger et al. [28]. The ACE1 activity is expressed in ηmol His-leu/min/mg of protein for each tissue sample.

ACE2 activity assay

The PVAT from the thoracic aortas was homogenized using ACE2 buffer (75 mmol/l Tris-HCl, 1 mol/l NaCl, 0.5 μmol/l ZnCl2, pH 7.5). The tissue extracts were centrifuged (10,000 rpm for 10 min at 4°C), and the supernatant was retained. The ACE2 activity assay was performed using a microplate reader (BioTekSynergyTM2; Biotek, Winooski, VT, U.S.A.) as previously described [28]. The results are expressed as fluorescence (a.u.)/minute/mg of protein.

Angiotensin II enzyme immunoassay

The PVAT from the thoracic aortas of all the study groups was homogenized in cold PBS buffer (NaCl 150 mmol/l; Na2HPO4 7.2 mmol/l; NaH2PO4 2.8 mmol/l, pH 7.4) containing protease inhibitors (pepstatin 0.7 mg/ml; leupeptin 0.5 mg/ml; and PMSF 40 mg/ml) and phosphatase inhibitors [sodium fluoride 15 mmol/l; sodium pyrophosphate 50 mmol/l; phosphatase inhibitor cocktail 2 (1:1000, Sigma-Aldrich); and phosphatase inhibitor cocktail 3 (1:1000, Sigma-Aldrich)] [29]. Seven hundred micrograms of the crude homogenate was utilized to measure the contents of angiotensin II using the Angiotensin II Enzyme Immunoassay Kit (Cat. EKE-002-12; Phoenix Pharmaceutical Inc., Burlingame, CA, U.S.A.), according to the manufacturer’s instructions.

Gene expression analysis

Total RNA was isolated from the thoracic aortic tissues and their respective PVAT using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.) according to the manufacturer’s instructions. cDNA was synthesized with the qPCR-SuperMix-UDG Kit (Invitrogen, CA, U.S.A.) from 1 µg of total RNA in a total volume of 20 µl with oligo (dT) primers (Invitrogen, CA, U.S.A.) [28]. Quantitative RT-PCR was performed in a thermocycler (Cobertt Research, Sydney, Australia) using SYBR Green PCR (Invitrogen). cDNA was used as a template for PCR with the following specific primers (Table 1).

Table 1
The gene name and primer sequences
GenePrimer sequence (5′-3′)
AT1R F: CACTTTCCTGGATGTGCTGA 
 R: CCCAGAAAGCCGTAGAACAG 
AT2R F: GTAAGAATTTGGAGTTGCTG 
 R: GGGATTCCTTCTTTGAGAC 
ACE1 F: TGGACTTCTCCAACAAGATCGCCA 
 R: TTCTCCTTGGTGATGCTTCCGTC 
ACE2 F: TTGTTGGAACGCTGCCATTT 
 R: CCAACGATCTCCCGCTTCAT 
GAPDH F: AGTGCCAGCCTCGTCTCATA 
 R: ATGAAGGGGTCGTTGATGGC 
UCP-1 F: ATCTTCTCAGCCGGCGTTTC 
 R: CCTTGGATCTGAAGGCGGAC 
PRDM-16 F: TGATGGCCGCTTGGAAGA 
 R: TCACTGCCATCCGACATGTC 
EPSTI-1 F: ACCCTGATAGCACCAAACGA 
 R: AGGTCTGCCAGTTCTTGCTC 
TCF-21 F: TCCAAGCTGGACACTCTCAG 
 R: TAAAGGGCCAAGTCAGGTTGA 
HPRT-1 F: ACAGGCCAGACTTTGTTGGA 
 R: TGGCTTTTCCACTTTCGCTG 
GenePrimer sequence (5′-3′)
AT1R F: CACTTTCCTGGATGTGCTGA 
 R: CCCAGAAAGCCGTAGAACAG 
AT2R F: GTAAGAATTTGGAGTTGCTG 
 R: GGGATTCCTTCTTTGAGAC 
ACE1 F: TGGACTTCTCCAACAAGATCGCCA 
 R: TTCTCCTTGGTGATGCTTCCGTC 
ACE2 F: TTGTTGGAACGCTGCCATTT 
 R: CCAACGATCTCCCGCTTCAT 
GAPDH F: AGTGCCAGCCTCGTCTCATA 
 R: ATGAAGGGGTCGTTGATGGC 
UCP-1 F: ATCTTCTCAGCCGGCGTTTC 
 R: CCTTGGATCTGAAGGCGGAC 
PRDM-16 F: TGATGGCCGCTTGGAAGA 
 R: TCACTGCCATCCGACATGTC 
EPSTI-1 F: ACCCTGATAGCACCAAACGA 
 R: AGGTCTGCCAGTTCTTGCTC 
TCF-21 F: TCCAAGCTGGACACTCTCAG 
 R: TAAAGGGCCAAGTCAGGTTGA 
HPRT-1 F: ACAGGCCAGACTTTGTTGGA 
 R: TGGCTTTTCCACTTTCGCTG 

The samples were run in duplicate. The analysis of the gene of interest was normalized to the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for AT1R, AT2R, ACE1 and ACE2, and hypoxanthine phosphoribosyl transferase 1 (HPRT-1) for brown [uncoupling protein-1 (UCP-1) and PR-domain containing 16 (PRDM-16)], beige [epithelial stromal Interaction 1 (EPSTI-1)] and white [transcription factor 21 (TCF-21)] adipose tissue markers. The data are expressed as the fold of induction in relation to the control.

Statistical analysis

The values are presented as the mean ± SEM, and n represents the number of animals used in each group or experiment. Shapiro–Wilk test was used to check the normality of the data. Student’s t-test or one- or two-way ANOVA were used as appropriate, followed by the Bonferroni post hoc test (Graph Pad Prism Software). A value of P<0.05 was considered statistically significant.

Results

Twelve weeks after surgery, the MI animals presented a decrease in left ventricular systolic pressure (LVSP) and an increase in left ventricular end-diastolic pressure (LVEDP) compared with SO animals (Table 2). Moreover, a reduced contractile index (+dP/dt) and relaxation velocity (-dP/dt) were observed in the MI rats compared with the SO rats (Table 2). No significant changes were found in heart rate between groups (Table 2).

Table 2
Hemodynamic and morphometric parameters evaluated in sham-operated (SO) and heart failure (HF) after myocardial infarction rats
SOHF
n 39 45 
Hemodynamic values   
LVSP, mmHg 139.6 ± 2.12 120.7 ±1.31* 
LVEDP, mmHg 4.28 ± 0.49 13.15 ± 1.49* 
+ dP/dt, mmHg/s 8064 ± 246 5608 ± 157* 
- dP/dt, mmHg/s -4941 ± 127 -3932 ± 106* 
HR, beats/min 343.9 ± 5.97 339.9 ± 4.02 
Morphometric values   
Infarct area, % of LV 37.5 ± 0.86 
Body weight, g 471 ± 9.31 442 ± 8.71* 
Tibia length, mm 41.6 ± 0.17 41.3 ± 0.17 
LVW/Tibia ratio, mg/mm 19.1 ± 0.34 18.3 ± 0.47 
RVW/Tibia ratio, mg/mm 4.97 ± 0.13 12.67 ± 0.34* 
Lung/Tibia ratio, mg/mm 50.4 ± 2.03 92.0 ± 3.34* 
SOHF
n 39 45 
Hemodynamic values   
LVSP, mmHg 139.6 ± 2.12 120.7 ±1.31* 
LVEDP, mmHg 4.28 ± 0.49 13.15 ± 1.49* 
+ dP/dt, mmHg/s 8064 ± 246 5608 ± 157* 
- dP/dt, mmHg/s -4941 ± 127 -3932 ± 106* 
HR, beats/min 343.9 ± 5.97 339.9 ± 4.02 
Morphometric values   
Infarct area, % of LV 37.5 ± 0.86 
Body weight, g 471 ± 9.31 442 ± 8.71* 
Tibia length, mm 41.6 ± 0.17 41.3 ± 0.17 
LVW/Tibia ratio, mg/mm 19.1 ± 0.34 18.3 ± 0.47 
RVW/Tibia ratio, mg/mm 4.97 ± 0.13 12.67 ± 0.34* 
Lung/Tibia ratio, mg/mm 50.4 ± 2.03 92.0 ± 3.34* 

Values are presented as the mean ± SEM. n, number of animals; LV, left ventricle; LVSP, left ventricle systolic pressure; LVEDP, left ventricle end-diastolic pressure; +dP/dt, first time positive derivative; -dP/dt, first time negative derivative; HR, heart rate; LVW/Tibia, ratio of left ventricle weight and tibia length; RVW/Tibia, ratio of right ventricle weight and tibia length; Lung/Tibia, ratio of lung weight and tibia length. Significance was assessed using Student's t-test. *P<0.05 vs. SO.

The morphometric data (Table 2) showed that the body weight was reduced while the right ventricle hypertrophy index and the degree of pulmonary congestion were increased in the MI group compared with the SO group. No change in the left ventricular hypertrophy index was observed between the groups (Table 2).

Taken together, these hemodynamic and morphometric results confirm previously published results [24,25] showing severe ventricular dysfunction and pulmonary congestion 12 weeks after the permanent occlusion of the left coronary artery; these findings demonstrate that the animals used in the present study showed clear signs of heart failure after MI. Thus, the rats submitted to MI surgery will be called heart failure (HF) rats.

HF post MI induces a marked reduction in the anticontractile effect of thoracic aorta PVAT

The phenylephrine-induced contraction of the aortic rings with intact endothelium (E+) in the presence or absence of PVAT from the HF and SO rats was assessed. The phenylephrine-induced contraction (Emax and pD2 values) was greater in the rings of HF rats than in those of SO rats (Figure 2A). PVAT reduced the phenylephrine-induced contraction in the aortic rings of SO rats, while this response was significantly attenuated in the HF rats compared with the SO rats (Figure 2A).

Heart failure changes the quality and impairs the anticontractile effect of thoracic aorta PVAT

Figure 2
Heart failure changes the quality and impairs the anticontractile effect of thoracic aorta PVAT

Phenylephrine-induced contraction (A) in thoracic aorta rings with functional endothelium in the presence (PVAT+) or absence (PVAT-) of perivascular adipose tissue from sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of PVAT in both groups. (B) Representative hematoxylin and eosin images of thoracic aorta PVAT in transverse sections of SO and HF rats. The scale bar represents 100 μm. The white box is a higher magnification (150%) of each representative image, the asterisk represents the unilocular adipocytes and the arrow represents multilocular adipocytes. (C) Gene expression of brown (UCP-1 and PRDM-16), beige (EPSTI-1) and white (TCF-21) adipose tissue markers in thoracic aorta PVAT from SO and HF rats. The results of gene expression are expressed as the relative expression value obtained in the SO animals. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by two-way ANOVA or Student's t-test as appropriate; *P<0.05 vs. SO; #P<0.05 vs. PVAT-.

Figure 2
Heart failure changes the quality and impairs the anticontractile effect of thoracic aorta PVAT

Phenylephrine-induced contraction (A) in thoracic aorta rings with functional endothelium in the presence (PVAT+) or absence (PVAT-) of perivascular adipose tissue from sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of PVAT in both groups. (B) Representative hematoxylin and eosin images of thoracic aorta PVAT in transverse sections of SO and HF rats. The scale bar represents 100 μm. The white box is a higher magnification (150%) of each representative image, the asterisk represents the unilocular adipocytes and the arrow represents multilocular adipocytes. (C) Gene expression of brown (UCP-1 and PRDM-16), beige (EPSTI-1) and white (TCF-21) adipose tissue markers in thoracic aorta PVAT from SO and HF rats. The results of gene expression are expressed as the relative expression value obtained in the SO animals. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by two-way ANOVA or Student's t-test as appropriate; *P<0.05 vs. SO; #P<0.05 vs. PVAT-.

It is important to emphasize that the weight of the thoracic aorta PVAT did not differ between the groups (SO: 13.7 ± 0.02 (n=10) vs. HF: 14.5 ± 0.92 (n=14) mg/mm; Student’s t-test, P>0.05). Despite similar mass, HF promoted profound changes in PVAT morphology as evaluated by hematoxylin and eosin staining (Figure 2B). HF markedly increased PVAT lipid deposition, adipocyte diameter and number of unilocular adipocytes. This was associated with a significant reduction in PVAT multilocular adipocytes (Figure 2B) and mRNA levels of several markers of brown (UCP-1 and PRDM-16) and beige (EPSTI-1) adipocytes (Figure 2C). HF also increased PVAT mRNA levels of TCF-21, a marker of white adipocytes (Figure 2C).

In the aortic rings with (E+) or without (E-) endothelium from the SO rats, the PVAT showed an anticontractile response to phenylephrine (reduced Emax and pD2 values) (Figure 3A). However, in the E- rings of the SO rats, the magnitude of the PVAT response was lower than that of the E+ rings (Figure 3A). These data confirm published results showing that the anticontractile effect of PVAT in normal control arteries is both endothelium-dependent and endothelium-independent [1,26]. However, in the HF group, the phenylephrine-induced contraction did not differ in the presence or absence of PVAT in the E+ or in the E- rings (Figure 3B).

The endothelium-dependent and endothelium-independent anticontractile effect of thoracic aorta PVAT is substantially reduced in rats with heart failure

Figure 3
The endothelium-dependent and endothelium-independent anticontractile effect of thoracic aorta PVAT is substantially reduced in rats with heart failure

Concentration–response curves to phenylephrine in thoracic aorta rings with (E+) or without (E-) endothelium in the presence (PVAT+) or absence (PVAT-) of perivascular adipose tissue from sham-operated (SO) animals (A) and heart failure (HF) after myocardial infarction animals (B). The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of endothelium and/or PVAT in both groups. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by two-way ANOVA; #P<0.05 vs. PVAT-; &P<0.05 vs. E+.

Figure 3
The endothelium-dependent and endothelium-independent anticontractile effect of thoracic aorta PVAT is substantially reduced in rats with heart failure

Concentration–response curves to phenylephrine in thoracic aorta rings with (E+) or without (E-) endothelium in the presence (PVAT+) or absence (PVAT-) of perivascular adipose tissue from sham-operated (SO) animals (A) and heart failure (HF) after myocardial infarction animals (B). The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of endothelium and/or PVAT in both groups. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by two-way ANOVA; #P<0.05 vs. PVAT-; &P<0.05 vs. E+.

Altogether, these results suggest that the impaired anticontractile effect of PVAT in the thoracic aortas of rats with HF post MI is associated with a previously unrecognized change in PVAT morphofunctional properties characterized by a shift from a brown/beige pro-thermogenic to a white lipid-storing profile.

Oxidative stress and reduced NO bioavailability are involved in the impaired anticontractile effect of PVAT in HF post MI rats

NO is an important vasodilating factor that is released by both the endothelium and PVAT of the thoracic aorta, and the endothelial dysfunction observed in HF is characterized by reduced NO bioavailability [17–20,26]. Thus, to evaluate the role of NO bioavailability in the reduced anticontractile effect of the PVAT in the HF thoracic aorta, vascular reactivity experiments were performed in E+ rings, with or without PVAT, that were preincubated with L-NAME, a nonselective NOS inhibitor. In addition, ROS production was assessed by DHE fluorescence experiments.

L-NAME increased the phenylephrine-induced contraction of the aortic rings in the presence or absence of PVAT in both HF and SO rats (Figure 4A–D). This effect was greater in SO rats (increased both Emax and pD2 values) than HF rats (increased only pD2 values), in either PVAT+ rings or PVAT- rings (Figure 4A–D).

Heart failure induces lower NO bioavailability and oxidative stress in thoracic aortic rings and PVAT when compared with sham-operated rats

Figure 4
Heart failure induces lower NO bioavailability and oxidative stress in thoracic aortic rings and PVAT when compared with sham-operated rats

The effect of nitric oxide synthase inhibition (L-NAME) on phenylephrine-induced contraction in thoracic aorta rings with functional endothelium in the absence (PVAT-) (A,C) or the presence (PVAT+) (B,D) of perivascular adipose tissue from sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of L-NAME in each condition. Representative fluorographs (top) and quantified (bottom) DHE fluorescence obtained from transverse sections of vessel walls (E) and their PVAT (F) from thoracic aortas of both groups studied. The scale bar represents 50 μm. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student’s t-test; *P<0.05 vs. SO; &P<0.05 vs. without L-NAME.

Figure 4
Heart failure induces lower NO bioavailability and oxidative stress in thoracic aortic rings and PVAT when compared with sham-operated rats

The effect of nitric oxide synthase inhibition (L-NAME) on phenylephrine-induced contraction in thoracic aorta rings with functional endothelium in the absence (PVAT-) (A,C) or the presence (PVAT+) (B,D) of perivascular adipose tissue from sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The bar graph in figures represents the pD2 to phenylephrine in the presence or absence of L-NAME in each condition. Representative fluorographs (top) and quantified (bottom) DHE fluorescence obtained from transverse sections of vessel walls (E) and their PVAT (F) from thoracic aortas of both groups studied. The scale bar represents 50 μm. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student’s t-test; *P<0.05 vs. SO; &P<0.05 vs. without L-NAME.

In addition, the hydroethidine fluorescence intensity was higher in the sections of both the thoracic aortas (Figure 4E) and PVAT (Figure 4F) from the HF animals than in those of the SO animals. Taken together, these results suggest that the decreased PVAT-induced anticontractile effect observed in the thoracic aortas of the HF rats is associated with reduced NO bioavailability and enhanced ROS production.

RAS hyperactivation is involved in the reduced anticontractile effect of PVAT in HF post MI rats

As described in the introduction section, the RAS components are expressed in PVAT [10], and higher angiotensin II levels induce oxidative stress and reduce NO bioavailability in the vascular wall [18,19,30,31]. Thus, we performed experiments to assess the expression/activity of the RAS components in the thoracic aorta PVAT of HF rats.

ACE1 activity is the key step in RAS activation. Interestingly, the ACE1 activity was increased in the PVAT of the HF animals compared with that of the SO animals (Figure 5A), but no difference was observed in ACE1 gene expression (Figure 5B). Consistent with this result, higher angiotensin II levels were observed in the PVAT of the HF rats (Figure 5G). On the other hand, no change was found in ACE2 activity (Figure 5C) or in its gene expression (Figure 5D) in either group. The PVAT of the HF rats also presented enhanced AT1R and AT2R mRNA levels compared to that of the SO rats (Figure 5E,F). In addition, no significant changes were found in ACE1 activity or AT1R and AT2R mRNA levels in the thoracic aorta between groups (Supplementary Figure S1).

Heart failure induces ACE1/angiotensin II/ATR overactivation in thoracic aorta PVAT

Figure 5
Heart failure induces ACE1/angiotensin II/ATR overactivation in thoracic aorta PVAT

Activity (A,C) and gene expression (B,D) of angiotensin-converting enzymes 1 (ACE1) (A,B) and 2 (ACE2) (C,D), gene expression of type 1 angiotensin II receptor (AT1R) (E) and type 2 angiotensin II receptor (AT2R) (F) and levels of angiotensin II (G) in thoracic aorta PVAT of sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The number of animals used is expressed in dots. The results of gene expression are expressed as the mean ± SEM of the relative expression value obtained in the SO animals, whereas the other data are presented as absolute values. The significant differences were determined by Student's t-test; *P<0.05 vs. SO.

Figure 5
Heart failure induces ACE1/angiotensin II/ATR overactivation in thoracic aorta PVAT

Activity (A,C) and gene expression (B,D) of angiotensin-converting enzymes 1 (ACE1) (A,B) and 2 (ACE2) (C,D), gene expression of type 1 angiotensin II receptor (AT1R) (E) and type 2 angiotensin II receptor (AT2R) (F) and levels of angiotensin II (G) in thoracic aorta PVAT of sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The number of animals used is expressed in dots. The results of gene expression are expressed as the mean ± SEM of the relative expression value obtained in the SO animals, whereas the other data are presented as absolute values. The significant differences were determined by Student's t-test; *P<0.05 vs. SO.

To functionally evaluate the involvement of the RAS in the PVAT dysfunction observed in HF rats, AT1R and AT2R antagonists were used in vitro for vascular reactivity experiments. In the E+ rings, losartan was able to reduce the phenylephrine-induced contraction in both groups in the presence or absence of PVAT (Figure 6A,B,E,F). However, this reduction was greater in the aortic rings of the HF rats than in those of the SO rats. In addition, the effect of AT1R antagonism was higher in the PVAT+ rings than in the PVAT- rings of the HF rats, while its effect was similar in the SO animals (Compare Figure 6A,B,E,F). Remarkably, in the absence of endothelium (E-), losartan only significantly reduced the phenylephrine-induced contraction in the aortic rings of the HF rats with PVAT (Figure 6C,D,G,H).

AT1 receptor is involved in reducing the anticontractile effect in thoracic aorta PVAT of rats with heart failure

Figure 6
AT1 receptor is involved in reducing the anticontractile effect in thoracic aorta PVAT of rats with heart failure

The effect of the type 1 angiotensin II receptor antagonist losartan (LOS) on phenylephrine-induced contraction in thoracic aorta rings in the presence (E+) (A,B,E,F) and absence (E-) (C,D,G,H) of endothelium and in the presence (PVAT+) (B,D,F,H) or absence (PVAT-) (A,C,E,G) of perivascular adipose tissue of the sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The inset bar graph in figures represents the pD2 to phenylephrine in the presence or absence of losartan (LOS) in each condition. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student's t-test; &P<0.05 vs. without Losartan.

Figure 6
AT1 receptor is involved in reducing the anticontractile effect in thoracic aorta PVAT of rats with heart failure

The effect of the type 1 angiotensin II receptor antagonist losartan (LOS) on phenylephrine-induced contraction in thoracic aorta rings in the presence (E+) (A,B,E,F) and absence (E-) (C,D,G,H) of endothelium and in the presence (PVAT+) (B,D,F,H) or absence (PVAT-) (A,C,E,G) of perivascular adipose tissue of the sham-operated (SO) animals and heart failure (HF) after myocardial infarction animals. The inset bar graph in figures represents the pD2 to phenylephrine in the presence or absence of losartan (LOS) in each condition. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student's t-test; &P<0.05 vs. without Losartan.

The effect of the AT2R antagonist (PD123319) on E+ rings was more variable depending on the animal model and presence or absence of PVAT in the aortic rings. Thus, in the E+/ PVAT- rings of the SO rats, PD123319 increased the contractile response to phenylephrine, while no change in this response was observed in the rings E+/PVAT+ (Figure 7A,B). In contrast, AT2R antagonism reduced the Emax to phenylephrine in the E+/PVAT- or E+/PVAT+ rings of the HF rats (Figure 7E,F). However, in the HF rats, the magnitude of the PD123319 effect was greater in the presence than in the absence of PVAT. In the E- rings, the AT2R antagonist only reduced the phenylephrine-induced contraction of the PVAT+ rings of the HF rats (Figure 7C,D,G,H). It is important to note that AT1R or AT2R antagonism in the thoracic aorta rings with or without endothelium and with or without PVAT (Figures 6 and 7E–H) caused similar effects on the phenylephrine response in the HF rats, but with different magnitudes of responses (compare Figures 6 and 7, respectively).

The pro-contractile effect of AT2 receptor in thoracic aorta PVAT of rats with heart failure

Figure 7
The pro-contractile effect of AT2 receptor in thoracic aorta PVAT of rats with heart failure

The effect of the type 2 angiotensin II receptor antagonist PD123319 on phenylephrine-induced contraction in thoracic aorta rings in the presence (E+) (A,B,E,F) and absence (E-) (C,D,G,H) of endothelium and in the presence (PVAT+) (B,D,F,H) or absence (PVAT-) (A,C,E,G) of perivascular adipose tissue of sham-operated animals (SO) and heart failure (HF) after myocardial infarction animals. The inset bar graph in figures represents the pD2 to phenylephrine in the presence or absence of PD123319 in each condition. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student's t-test; &P<0.05 vs. without PD123319.

Figure 7
The pro-contractile effect of AT2 receptor in thoracic aorta PVAT of rats with heart failure

The effect of the type 2 angiotensin II receptor antagonist PD123319 on phenylephrine-induced contraction in thoracic aorta rings in the presence (E+) (A,B,E,F) and absence (E-) (C,D,G,H) of endothelium and in the presence (PVAT+) (B,D,F,H) or absence (PVAT-) (A,C,E,G) of perivascular adipose tissue of sham-operated animals (SO) and heart failure (HF) after myocardial infarction animals. The inset bar graph in figures represents the pD2 to phenylephrine in the presence or absence of PD123319 in each condition. The number of animals used in each experiment (n) is in parentheses or expressed in dots. The results are expressed as the mean ± SEM. The statistical analysis was assessed by Student's t-test; &P<0.05 vs. without PD123319.

Together, these results highlight the pivotal role of the overactivation of the ACE1/angiotensin II/AT1R and AT2R axes in PVAT and vascular dysfunction observed in the thoracic aortas of HF rats.

Discussion

The new and main finding of the present study is the pivotal role of PVAT dysfunction, through its shift to a lipid storing profile (whitening) and RAS hyperactivation, in the vascular alterations observed in HF rats post MI.

It is well known that PVAT regulates vascular tone through the release of vasoactive mediators that directly or through endothelial mediation modulate smooth muscle contractility [1,3,4,26]. In the present study, we observed, for the first time, that the PVAT of the thoracic aortas from HF rats, independently of endothelium presence, lost its anticontractile effect. This effect was also observed in hypertension [9], diabetes [32], obesity [2,27], vascular inflammation and aneurysm [7], and atherosclerosis [33]. The reduced anticontractile effect of PVAT is associated with changes in its phenotype in several of these diseases [9,27,34,35]. Consistent with these works, in the present study, we observed that the quality of the PVAT changes in HF, as the weight of the thoracic aorta PVAT did not change but clear markers of the shift from a brown/beige pro-thermogenic to a white lipid-storing profile were observed. An increased amount of white adipose tissue was observed, as the reduced gene expression of brown (UCP-1 and PRDM-16) and beige (EPSTI-1) and the enhanced gene expression of white (TCF-21) adipose tissue markers [36].

Among the factors that could contribute to the reduced anticontractile effect of the PVAT in the thoracic aortas of HF rats, we first investigated NO bioavailability. Indeed, the present data showed an important reduction in the NO bioavailability of the PVAT of HF rats. We, in the present study and previously, and other groups have already shown that NO is an important vasodilating factor that is released by healthy PVAT [26,35]. Moreover, in the HF thoracic aorta, the NOS inhibitor promoted a modest effect both in the presence and absence of PVAT. The literature shows that reduced NO availability is observed in HF-induced endothelial dysfunction [18–20,24,30], and the present study adds to this knowledge of HF PVAT. Reduced NO bioavailability can occur by reducing NO synthesis and/or by increasing NO degradation by ROS [19,20,24,30,31,35,37]. We observed an increase in ROS production in both the thoracic aorta and PVAT of the HF post MI rats, suggesting that oxidative stress can be involved in the reduced NO bioavailability found in HF.

It is well known that the vascular and endothelial dysfunction, oxidative stress and vascular inflammation observed in HF animal models and patients are associated with RAS hyperactivation [16–19]. The RAS is also involved in the regulation of adiposity and PVAT function [10,12,38,39]. Previous studies have found the expression of the components of the local RAS in adipose tissue (visceral, subcutaneous and cells isolated from breast adipose tissue) in humans [12]. The expression of these components was also observed in the white PVAT that surrounds the mesenteric artery [10,38] and in the brown/beige PVAT that surrounds the thoracic aorta of rats [10,39]. Several researchers suggest that the production of RAS components by adipocytes may have an important link to the onset of cardiovascular diseases [40] and that RAS hyperactivation may be responsible for endothelial and PVAT dysfunction in different vascular beds, as has already been observed in clinical and experimental conditions [7,41].

In this regard, the present study demonstrated, for the first time, the involvement of local RAS overactivation in the PVAT dysfunction of HF animals. The thoracic aorta PVAT of these animals presented an increase in the activity of ACE1 and the level of its product, angiotensin II. Thus, these data support the notion that PVAT is also a source of the greater activation of the classic RAS axis in HF rats. The hyperactivation of the RAS systemically, accompanied by elevated plasma levels of angiotensin II, is an important feature of HF [42]. In HF, local RAS hyperactivation is also observed in other tissues, such as cardiac tissue [43,44], while we observed no changes in ACE1 activity in the thoracic aorta of the HF rats compared with that of the SO rats (Supplementary Figure S1C). Moreover, this system is an important factor in determining endothelial dysfunction, especially in HF [16,18,19], and studies have shown that its antagonism reduces vascular damage in HF [16,18,19,45,46]. However, the present study showed PVAT as an essential promoter of local RAS activation, which leads to the vascular pathophysiology observed in HF.

Although it is well known that angiotensin 1-7, a peptide produced by ACE2 activity, is an important endothelium-dependent and PVAT-dependent vasodilating factor [11,47] and that a reduction in the ACE2/angiotensin 1-7/Mas receptor axis is involved in cardiovascular diseases [28,48], our results show that ACE2 activity and its gene expression did not change in the PVAT of the HF rats compared with that of the SO rats. These results led us to exclude, at this moment, the involvement of this anticontractile RAS axis in the PVAT dysfunction observed in the present study.

To functionally show the role of local angiotensin II on the PVAT dysfunction observed in HF, the present study assessed the acute inhibitory effect of AT1R and AT2R on vascular reactivity assays. The effect of AT1R and AT2R antagonism on the attenuation of phenylephrine-induced contraction was higher in the HF arteries than in the SO arteries. In addition, the presence of PVAT amplified this effect. It is also interesting to note that in rings without endothelium, both losartan and PD123319 were able to reduce phenylephrine-induced contraction only in arteries with PVAT from the HF rats. Confirming this finding, we observed increased gene expression of AT1R and AT2R in the PVAT of the HF rats compared with that of the SO rats, whereas no change in the gene expression of these receptors was observed in the thoracic aorta (Supplementary Figure S1A and B). Taken together, these results prove the importance of local ACE1/angiotensin II/AT1R and AT2R axes to the PVAT dysfunction observed in HF post MI and to the classic endothelial dysfunction observed in this disease.

However, it is interesting to note the shift in AT2R function in the vasculature of the HF animals. In aortic rings with endothelium of the SO animals, as expected, we observed an increase in the phenylephrine-induced contraction in the presence of AT2R antagonism, confirming the relaxation and anticontractile action of AT2R observed in both conductance and resistance arteries [49–51]. On the other hand, in the aortic rings of the HF rats, AT2R, similar to AT1R, exerts a procontractile effect. This contractile effect of AT2R was also observed in the renal artery when NO bioavailability was pharmacologically reduced [52]. Thus, as lower NO bioavailability was observed in the aorta and PVAT of HF rats, this mechanism may contribute to the functional change in AT2R, inducing a constricted profile in the HF animals. These results led us to believe that in the aortas of HF animals, AT2R loses its counter-regulatory function, while angiotensin II, via AT2R, also contributes to vascular hyperreactivity due to a pathway that is dependent on the endothelium and that is amplified by PVAT.

From this perspective, the consequences of this combination of effects deserve further investigation, since many patients with HF use an AT1R antagonist [53], and the repercussions of this antagonism of AT2R on PVAT have been ignored. AT1R blockade increases the endogenous levels of angiotensin II [51] due to the residual angiotensin II-formation activity in the vascular wall [54]. In addition, one should consider the reported role of PD123319 as Mas receptor antagonist [55] and/or as blocker of angiotensin 1-7 effects on AT2R [56] beyond its action as an AT2R antagonist, and a definite conclusion on this issue regarding an unspecific profile of P123319 requires further studies [57]. Therefore, a range of questions and perspectives regarding the pathophysiology of PVAT in HF, as well as the pharmacological repercussions in different vascular beds, remain to be addressed.

Conclusion

In summary, the present study shows that PVAT is dysfunctional in the thoracic aortas of HF post MI rats, and our data indicate some molecular pathways involved in these alterations. Through the overactivation of ACE1/angiotensin II/AT1R and AT2R, which causes oxidative stress and, consequently, reduces NO bioavailability, the anticontractile effect of PVAT is impaired in the thoracic aorta of HF rats (Figure 8). These data highlight the importance of the PVAT phenotype and dysfunction to the pathophysiology of the vascular disease observed in HF, which could be associated with the endothelial dysfunction and atherosclerosis commonly observed in this disease and provide new perspectives for the treatment of this syndrome.

Illustration of PVAT changes observed in thoracic aorta of heart failure rats

Figure 8
Illustration of PVAT changes observed in thoracic aorta of heart failure rats

This illustration summarizes the main results obtained in the present study. Thoracic aorta PVAT of heart failure (HF) after myocardial infarction animals is dysfunctional and changes its secretory function compared with sham-operated animals (SO). These adjustments are associated with the overactivation of ACE1/angiotensin II/AT1R and AT2R axes, which causes oxidative stress and, consequently, reduces NO bioavailability. Figure was prepared using the BioRender program (biorender.com/).

Figure 8
Illustration of PVAT changes observed in thoracic aorta of heart failure rats

This illustration summarizes the main results obtained in the present study. Thoracic aorta PVAT of heart failure (HF) after myocardial infarction animals is dysfunctional and changes its secretory function compared with sham-operated animals (SO). These adjustments are associated with the overactivation of ACE1/angiotensin II/AT1R and AT2R axes, which causes oxidative stress and, consequently, reduces NO bioavailability. Figure was prepared using the BioRender program (biorender.com/).

Clinical perspectives

  • It is well known that renin–angiotensin system components are expressed in the PVAT. On the other hand, the physiological anticontractile effect of PVAT is impaired in the presence of cardiometabolic diseases.

  • The present study shows the impaired anticontractile effect of PVAT associated with a whitening of this tissue in the thoracic aortas of HF rats. In addition, it demonstrated the pivotal role of overactivation of the ACE1/angiotensin II/AT1R and AT2R axes in HF-induced PVAT dysfunction.

  • The role of dysfunctional PVAT secretory function to the pathophysiology of vascular alterations in HF open a range of perspectives regarding the PVAT as a target to the HF treatment.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the “Fundação de Amparo à Pesquisa do Estado de São Paulo” (FAPESP) [grant numbers 2016/08907-3 and 2014/20303-0] and by the “Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil” (CAPES, Finance Code 001). Maria Luiza de M. Barreto-Chaves, José G. Mill and Luciana V. Rossoni are research fellows from the “Conselho Nacional de Desenvolvimento Científico e Tecnológico” (CNPq, Brazil) [grant numbers 302022/2019-8, 302518/2019-3 and 306539/2017-9].

CRediT Author Contribution

Luciana Venturini Rossoni: Conceptualization, Funding acquisition, Resources, Supervision, Writing — original draft, Writing — review and editing. Milene Tavares Fontes: Conceptualization, Data curation, Investigation, Methodology, Validation, Writing — original draft, Writing — review and editing. Suliana Mesquita Paula: Data curation, Formal analysis, Investigation, Validation, Writing — original draft, Writing — review and editing. Caroline Antunes Lino: Data curation, Formal analysis, Investigation, Validation. Nathalia Senger: Data curation, Formal analysis, Investigation, Validation. Gisele Kruger Couto: Data curation, Formal analysis, Investigation, Methodology, Validation, Writing — review and editing. Maria Luiza de Morais Barreto-Chaves: Funding acquisition, Investigation, Writing — review and editing. José Geraldo Mill: Conceptualization, Writing — original draft, Writing — review and editing.

Acknowledgements

We thank Dr William Tadeu Lara Festuccia for your assistance in the adipose tissue markers analysis.

Abbreviations

     
  • +dP/dt

    contractile index

  •  
  • -dP/dt

    relaxation velocity

  •  
  • AT1R

    type 1 angiotensin II receptor

  •  
  • ACE1

    angiotensin-converting enzyme 1

  •  
  • ACE2

    angiotensin-converting enzyme 2

  •  
  • AT2R

    type 2 angiotensin II receptor

  •  
  • DHE

    dihydroethidium

  •  
  • Emax

    maximum response

  •  
  • EPSTI-1

    epithelial stromal Interaction 1

  •  
  • GAPDH

    glyceraldehyde-3-phosphate dehydrogenase

  •  
  • HF

    heart failure

  •  
  • HPRT-1

    hypoxanthine phosphoribosyl transferase 1

  •  
  • L-NAME

    N(ω)-nitro-L-arginine methyl ester

  •  
  • LVEDP

    left ventricular end-diastolic pressure

  •  
  • LVSP

    left ventricular systolic pressure

  •  
  • MI

    myocardial infarction

  •  
  • NO

    nitric oxide

  •  
  • pD2

    negative log of the agonist concentration producing 50% of maximum response

  •  
  • PRDM-16

    PR-domain containing 16

  •  
  • PVAT

    perivascular adipose tissue

  •  
  • RAS

    renin–angiotensin system

  •  
  • ROS

    reactive oxygen species

  •  
  • RT-PCR

    reverse-transcriptase polymerase chain reaction

  •  
  • SO

    Sham operation

  •  
  • TCF-21

    transcription factor 21

  •  
  • UCP-1

    uncoupling protein-1

References

References
1.
Gao
Y.J.
,
Lu
C.
,
Su
L.Y.
,
Sharma
A.M.
and
Lee
R.M.
(
2007
)
Modulation of vascular function by perivascular adipose tissue: the role of endothelium and hydrogen peroxide
.
Br. J. Pharmacol.
151
,
323
331
[PubMed]
2.
Greenstein
A.S.
,
Khavandi
K.
,
Withers
S.B.
,
Sonoyama
K.
,
Clancy
O.
,
Jeziorska
M.
et al.
(
2009
)
Local inflammation and hypoxia abolish the protective anticontractile properties of perivascular fat in obese patients
.
Circulation
119
,
1661
1670
[PubMed]
3.
Löhn
M.
,
Dubrovska
G.
,
Lauterbach
B.
,
Luft
F.C.
,
Gollasch
M.
and
Sharma
A.M.
(
2002
)
Periadventitial fat releases a vascular relaxing factor
.
FASEB J.
16
,
1057
1063
[PubMed]
4.
Soltis
E.E.
and
Cassis
L.A.
(
1991
)
Influence of perivascular adipose tissue on rat aortic smooth muscle responsiveness
.
Clin. Exp. Hypertension. Part A, Theory Pract.
13
,
277
296
5.
Gao
Y.J.
,
Zeng
Z.H.
,
Teoh
K.
,
Sharma
A.M.
,
Abouzahr
L.
,
Cybulsky
I.
et al.
(
2005
)
Perivascular adipose tissue modulates vascular function in the human internal thoracic artery
.
J. Thorac. Cardiovasc. Surg.
130
,
1130
1136
[PubMed]
6.
Dubrovska
G.
,
Verlohren
S.
,
Luft
F.C.
and
Gollasch
M.
(
2004
)
Mechanisms of ADRF release from rat aortic adventitial adipose tissue
.
Am. J. Physiol. Heart Circ. Physiol.
286
,
H1107
H1113
[PubMed]
7.
Sakaue
T.
,
Suzuki
J.
,
Hamaguchi
M.
,
Suehiro
C.
,
Tanino
A.
,
Nagao
T.
et al.
(
2017
)
Perivascular Adipose Tissue Angiotensin II Type 1 Receptor Promotes Vascular Inflammation and Aneurysm Formation
.
Hypertension (Dallas, Tex.: 1979)
70
,
780
789
8.
Rosei
C.A.
,
Withers
S.B.
,
Belcaid
L.
,
De Ciuceis
C.
,
Rizzoni
D.
and
Heagerty
A.M.
(
2015
)
Blockade of the renin-angiotensin system in small arteries and anticontractile function of perivascular adipose tissue
.
J. Hypertens.
33
,
1039
1045
[PubMed]
9.
Gálvez
B.
,
de Castro
J.
,
Herold
D.
,
Dubrovska
G.
,
Arribas
S.
,
González
M.C.
et al.
(
2006
)
Perivascular adipose tissue and mesenteric vascular function in spontaneously hypertensive rats
.
Arteriosclerosis, Thromb. Vasc. Biol.
26
,
1297
1302
10.
Gálvez-Prieto
B.
,
Bolbrinker
J.
,
Stucchi
P.
,
de Las Heras
A.I.
,
Merino
B.
,
Arribas
S.
et al.
(
2008
)
Comparative expression analysis of the renin-angiotensin system components between white and brown perivascular adipose tissue
.
J. Endocrinol.
197
,
55
64
[PubMed]
11.
Lee
R.M.
,
Lu
C.
,
Su
L.Y.
and
Gao
Y.J.
(
2009
)
Endothelium-dependent relaxation factor released by perivascular adipose tissue
.
J. Hypertens.
27
,
782
790
[PubMed]
12.
Engeli
S.
,
Negrel
R.
and
Sharma
A.M.
(
2000
)
Physiology and pathophysiology of the adipose tissue renin-angiotensin system
.
Hypertension (Dallas, Tex.: 1979)
35
,
1270
1277
13.
dos Santos
L.
,
Gonçalves
M.V.
,
Vassallo
D.V.
,
Oliveira
E.M.
and
Rossoni
L.V.
(
2006
)
Effects of high sodium intake diet on the vascular reactivity to phenylephrine on rat isolated caudal and renal vascular beds: Endothelial modulation
.
Life Sci.
78
,
2272
2279
[PubMed]
14.
Mazzolai
L.
,
Nussberger
J.
,
Aubert
J.F.
,
Brunner
D.B.
,
Gabbiani
G.
,
Brunner
H.R.
et al.
(
1998
)
Blood pressure-independent cardiac hypertrophy induced by locally activated renin-angiotensin system
.
Hypertension (Dallas, Tex.: 1979)
31
,
1324
1330
15.
Li
J.L.
,
Yang
Z.
,
Wu
S.
and
Kong
J.
(
2012
)
Relationship between endothelial nitric oxide synthase, insulin resistance and macrovascular disease in patients with acute myocardial infarction
.
J. Int. Med. Res.
40
,
687
693
[PubMed]
16.
Schäfer
A.
,
Fraccarollo
D.
,
Tas
P.
,
Schmidt
I.
,
Ertl
G.
and
Bauersachs
J.
(
2004
)
Endothelial dysfunction in congestive heart failure: ACE inhibition vs. angiotensin II antagonism
.
Eur. J. Heart Fail.
6
,
151
159
[PubMed]
17.
Bauersachs
J.
,
Bouloumié
A.
,
Fraccarollo
D.
,
Hu
K.
,
Busse
R.
and
Ertl
G.
(
1999
)
Endothelial dysfunction in chronic myocardial infarction despite increased vascular endothelial nitric oxide synthase and soluble guanylate cyclase expression: role of enhanced vascular superoxide production
.
Circulation
100
,
292
298
[PubMed]
18.
Bauersachs
J.
,
Heck
M.
,
Fraccarollo
D.
,
Hildemann
S.K.
,
Ertl
G.
,
Wehling
M.
et al.
(
2002
)
Addition of spironolactone to angiotensin-converting enzyme inhibition in heart failure improves endothelial vasomotor dysfunction: role of vascular superoxide anion formation and endothelial nitric oxide synthase expression
.
J. Am. Coll. Cardiol.
39
,
351
358
[PubMed]
19.
Hornig
B.
,
Landmesser
U.
,
Kohler
C.
,
Ahlersmann
D.
,
Spiekermann
S.
,
Christoph
A.
et al.
(
2001
)
Comparative effect of ace inhibition and angiotensin II type 1 receptor antagonism on bioavailability of nitric oxide in patients with coronary artery disease: role of superoxide dismutase
.
Circulation
103
,
799
805
[PubMed]
20.
Couto
G.K.
,
Britto
L.R.
,
Mill
J.G.
and
Rossoni
L.V.
(
2015
)
Enhanced nitric oxide bioavailability in coronary arteries prevents the onset of heart failure in rats with myocardial infarction
.
J. Mol. Cell Cardiol.
86
,
110
120
[PubMed]
21.
Souza
N.S.
,
Dos-Santos
R.C.
,
Silveira
A.L.
,
R
S.C.
,
Gantus
M.A.
,
Fortes
F.S.
et al.
(
2016
)
Effects of autonomic balance and fluid and electrolyte changes on cardiac function in infarcted rats: A serial study of sexual dimorphism
.
Clin. Exp. Pharmacol. Physiol.
43
,
476
483
[PubMed]
22.
Yu
Y.
,
Wei
S.G.
,
Weiss
R.M.
and
Felder
R.B.
(
2019
)
Sex differences in the central and peripheral manifestations of ischemia-induced heart failure in rats
.
Am. J. Physiol. Heart Circ. Physiol.
316
,
H70
H79
[PubMed]
23.
Pfeffer
M.A.
,
Pfeffer
J.M.
,
Fishbein
M.C.
,
Fletcher
P.J.
,
Spadaro
J.
,
Kloner
R.A.
et al.
(
1979
)
Myocardial infarct size and ventricular function in rats
.
Circ. Res.
44
,
503
512
[PubMed]
24.
Couto
G.K.
,
Paula
S.M.
,
Gomes-Santos
I.L.
,
Negrão
C.E.
and
Rossoni
L.V.
(
2018
)
Exercise training induces eNOS coupling and restores relaxation in coronary arteries of heart failure rats
.
Am. J. Physiol. Heart Circ. Physiol.
314
,
H878
H887
[PubMed]
25.
Paula
S.M.
,
Couto
G.K.
,
Fontes
M.T.
,
Costa
S.K.
,
Negrão
C.E.
,
Mill
J.G.
et al.
(
2019
)
Exercise training restores the myogenic response in skeletal muscle resistance arteries and corrects peripheral edema in rats with heart failure
.
Am. J. Physiol. Heart Circ. Physiol.
317
,
H87
H96
[PubMed]
26.
Victorio
J.A.
,
Fontes
M.T.
,
Rossoni
L.V.
and
Davel
A.P.
(
2016
)
Different Anti-Contractile Function and Nitric Oxide Production of Thoracic and Abdominal Perivascular Adipose Tissues
.
Front. Physiol.
7
,
295
[PubMed]
27.
Gil-Ortega
M.
,
Condezo-Hoyos
L.
,
García-Prieto
C.F.
,
Arribas
S.M.
,
González
M.C.
,
Aranguez
I.
et al.
(
2014
)
Imbalance between pro and anti-oxidant mechanisms in perivascular adipose tissue aggravates long-term high-fat diet-derived endothelial dysfunction
.
PLoS One
9
,
e95312
[PubMed]
28.
Senger
N.
,
Melo
M.B.
,
Diniz
G.P.
,
Campagnole-Santos
M.J.
,
Santos
R.
and
Barreto-Chaves
M.
(
2018
)
Angiotensin-(1-7) reduces cardiac effects of thyroid hormone by GSK3Β/NFATc3 signaling pathway
.
Clin. Sci. (London, England: 1979)
132
,
1117
1133
29.
Pontes
R.B.
,
Crajoinas
R.O.
,
Nishi
E.E.
,
Oliveira-Sales
E.B.
,
Girardi
A.C.
,
Campos
R.R.
et al.
(
2015
)
Renal nerve stimulation leads to the activation of the Na+/H+ exchanger isoform 3 via angiotensin II type I receptor
.
Am. J. Physiol. Renal. Physiol.
308
,
F848
F856
[PubMed]
30.
Bouloumié
A.
,
Bauersachs
J.
,
Linz
W.
,
Schölkens
B.A.
,
Wiemer
G.
,
Fleming
I.
et al.
(
1997
)
Endothelial dysfunction coincides with an enhanced nitric oxide synthase expression and superoxide anion production
.
Hypertension (Dallas, Tex.: 1979)
30
,
934
941
31.
Schulz
E.
,
Jansen
T.
,
Wenzel
P.
,
Daiber
A.
and
Münzel
T.
(
2008
)
Nitric oxide, tetrahydrobiopterin, oxidative stress, and endothelial dysfunction in hypertension
.
Antioxid. Redox Signaling
10
,
1115
1126
32.
Meijer
R.I.
,
Serne
E.H.
,
Smulders
Y.M.
,
van Hinsbergh
V.W.
,
Yudkin
J.S.
and
Eringa
E.C.
(
2011
)
Perivascular adipose tissue and its role in type 2 diabetes and cardiovascular disease
.
Curr. Diab. Rep.
11
,
211
217
[PubMed]
33.
Verhagen
S.N.
,
Vink
A.
,
van der Graaf
Y.
and
Visseren
F.L.
(
2012
)
Coronary perivascular adipose tissue characteristics are related to atherosclerotic plaque size and composition. A post-mortem study
.
Atherosclerosis
225
,
99
104
[PubMed]
34.
Lu
C.
,
Su
L.Y.
,
Lee
R.M.
and
Gao
Y.J.
(
2011
)
Alterations in perivascular adipose tissue structure and function in hypertension
.
Eur. J. Pharmacol.
656
,
68
73
[PubMed]
35.
Xia
N.
,
Horke
S.
,
Habermeier
A.
,
Closs
E.I.
,
Reifenberg
G.
,
Gericke
A.
et al.
(
2016
)
Uncoupling of Endothelial Nitric Oxide Synthase in Perivascular Adipose Tissue of Diet-Induced Obese Mice
.
Arteriosclerosis, Thromb. Vasc. Biol.
36
,
78
85
36.
de Jong
J.M.
,
Larsson
O.
,
Cannon
B.
and
Nedergaard
J.
(
2015
)
A stringent validation of mouse adipose tissue identity markers
.
Am. J. Physiol. Endocrinol. Metab.
308
,
E1085
E1105
[PubMed]
37.
Li
H.
,
Witte
K.
,
August
M.
,
Brausch
I.
,
Gödtel-Armbrust
U.
,
Habermeier
A.
et al.
(
2006
)
Reversal of endothelial nitric oxide synthase uncoupling and up-regulation of endothelial nitric oxide synthase expression lowers blood pressure in hypertensive rats
.
J. Am. Coll. Cardiol.
47
,
2536
2544
[PubMed]
38.
Campbell
D.J.
and
Habener
J.F.
(
1987
)
Cellular localization of angiotensinogen gene expression in brown adipose tissue and mesentery: quantification of messenger ribonucleic acid abundance using hybridization in situ
.
Endocrinology
121
,
1616
1626
[PubMed]
39.
Cassis
L.A.
,
Lynch
K.R.
and
Peach
M.J.
(
1988
)
Localization of angiotensinogen messenger RNA in rat aorta
.
Circ. Res.
62
,
1259
1262
[PubMed]
40.
Kurata
A.
,
Nishizawa
H.
,
Kihara
S.
,
Maeda
N.
,
Sonoda
M.
,
Okada
T.
et al.
(
2006
)
Blockade of Angiotensin II type-1 receptor reduces oxidative stress in adipose tissue and ameliorates adipocytokine dysregulation
.
Kidney Int.
70
,
1717
1724
[PubMed]
41.
Husain
K.
,
Hernandez
W.
,
Ansari
R.A.
and
Ferder
L.
(
2015
)
Inflammation, oxidative stress and renin angiotensin system in atherosclerosis
.
World J. Biological Chem.
6
,
209
217
42.
Pfeffer
M.A.
,
Pfeffer
J.M.
,
Steinberg
C.
and
Finn
P.
(
1985
)
Survival after an experimental myocardial infarction: beneficial effects of long-term therapy with captopril
.
Circulation
72
,
406
412
[PubMed]
43.
Hokimoto
S.
,
Yasue
H.
,
Fujimoto
K.
,
Sakata
R.
and
Miyamoto
E.
(
1995
)
Increased angiotensin converting enzyme activity in left ventricular aneurysm of patients after myocardial infarction
.
Cardiovasc. Res.
29
,
664
669
[PubMed]
44.
Wang
D.H.
,
Yao
A.
,
Zhao
H.
and
DiPette
D.J.
(
1997
)
Distinct mechanisms of modulation of angiotensin II type I receptor gene expression in heart and aorta
.
Hypertension (Dallas, Tex.: 1979)
29
,
1104
1108
45.
Bauersachs
J.
and
Widder
J.D.
(
2008
)
Endothelial dysfunction in heart failure
.
Pharmacological Reports: PR
60
,
119
126
[PubMed]
46.
Werner
C.M.
and
Böhm
M.
(
2008
)
The therapeutic role of RAS blockade in chronic heart failure
.
Therapeutic Adv. Cardiovasc. Dis.
2
,
167
177
47.
Nóbrega
N.
,
Araújo
N.F.
,
Reis
D.
,
Facine
L.M.
,
Miranda
C.
,
Mota
G.C.
et al.
(
2019
)
Hydrogen peroxide and nitric oxide induce anticontractile effect of perivascular adipose tissue via renin angiotensin system activation
.
Nitric Oxide: Biol. Chem.
84
,
50
59
48.
Srivastava
P.
,
Badhwar
S.
,
Chandran
D.S.
,
Jaryal
A.K.
,
Jyotsna
V.P.
and
Deepak
K.K.
(
2019
)
Imbalance between Angiotensin II - Angiotensin (1-7) system is associated with vascular endothelial dysfunction and inflammation in type 2 diabetes with newly diagnosed hypertension
.
Diab. Metab. Syndrome
13
,
2061
2068
49.
Batenburg
W.W.
,
Garrelds
I.M.
,
Bernasconi
C.C.
,
Juillerat-Jeanneret
L.
,
van Kats
J.P.
,
Saxena
P.R.
et al.
(
2004
)
Angiotensin II type 2 receptor-mediated vasodilation in human coronary microarteries
.
Circulation
109
,
2296
2301
[PubMed]
50.
Hiyoshi
H.
,
Yayama
K.
,
Takano
M.
and
Okamoto
H.
(
2004
)
Stimulation of cyclic GMP production via AT2 and B2 receptors in the pressure-overloaded aorta after banding
.
Hypertension (Dallas, Tex.: 1979)
43
,
1258
1263
51.
Widdop
R.E.
,
Matrougui
K.
,
Levy
B.I.
and
Henrion
D.
(
2002
)
AT2 receptor-mediated relaxation is preserved after long-term AT1 receptor blockade
.
Hypertension (Dallas, Tex.: 1979)
40
,
516
520
52.
Muller
C.
,
Endlich
K.
,
Barthelmebs
M.
and
Helwig
J.J.
(
1997
)
AT2-antagonist sensitive potentiation of angiotensin II-induced vasoconstrictions by blockade of nitric oxide synthesis in rat renal vasculature
.
Br. J. Pharmacol.
122
,
1495
1501
[PubMed]
53.
Sander
G.E.
,
McKinnie
J.J.
,
Greenberg
S.S.
and
Giles
T.D.
(
1999
)
Angiotensin-converting enzyme inhibitors and angiotensin II receptor antagonists in the treatment of heart failure caused by left ventricular systolic dysfunction
.
Prog. Cardiovasc. Dis.
41
,
265
300
[PubMed]
54.
Okunishi
H.
,
Miyazaki
M.
and
Toda
N.
(
1984
)
Evidence for a putatively new angiotensin II-generating enzyme in the vascular wall
.
J. Hypertens.
2
,
277
284
[PubMed]
55.
Tetzner
A.
,
Gebolys
K.
,
Meinert
C.
,
Klein
S.
,
Uhlich
A.
,
Trebicka
J.
et al.
(
2016
)
G-Protein-Coupled Receptor MrgD is a receptor for angiotensin-(1-7) involving adenylyl cyclase, cAMP, and phosphokinase A
.
Hypertension
68
,
185
194
[PubMed]
56.
Bosnyak
S.
,
Jones
E.S.
,
Christopoulos
A.
,
Aguilar
M.I.
,
Thomas
W.G.
and
Widdop
R.E.
(
2011
)
Relative affinity of angiotensin peptides and novel ligands at AT1 and AT2 receptors
.
Clin. Sci. (Lond.)
121
,
297
303
[PubMed]
57.
Villela
D.
,
Leonhardt
J.
,
Patel
N.
,
Joseph
J.
,
Kirsch
S.
,
Hallberg
A.
et al.
(
2015
)
Angiotensin type 2 receptor (AT2R) and receptor Mas: a complex liaison
.
Clin. Sci. (Lond.)
128
,
227
234
[PubMed]

Author notes

*

Both authors contributed equally to this work.

Supplementary data