Abstract

Despite the tremendous progress made in recent years in assembling the human genome, tandemly repeated DNA elements remain poorly characterized. These sequences account for the vast majority of methylated sites in the human genome and their methylated state is necessary for this repetitive DNA to function properly and to maintain genome integrity. Furthermore, recent advances highlight the emerging role of these sequences in regulating the functions of the human genome and its variability during evolution, among individuals, or in disease susceptibility. In addition, a number of inherited rare diseases are directly linked to the alteration of some of these repetitive DNA sequences, either through changes in the organization or size of the tandem repeat arrays or through mutations in genes encoding chromatin modifiers involved in the epigenetic regulation of these elements.

Although largely overlooked so far in the functional annotation of the human genome, satellite elements play key roles in its architectural and topological organization. This includes functions as boundary elements delimitating functional domains or assembly of repressive nuclear compartments, with local or distal impact on gene expression. Thus, the consideration of satellite repeats organization and their associated epigenetic landmarks, including DNA methylation (DNAme), will become unavoidable in the near future to fully decipher human phenotypes and associated diseases.

Repetitive DNA accounts for more than half of the human genome [1] and refers to DNA sequences that exist from several hundred to several thousand copies per genome. Individual repeat units can be scattered throughout the genome. These so-called interspersed repeats mainly consist of retrotransposon-derived parasitic elements. In contrast, individual sequences can be repeated in tandem, one next to the other. The clustering of tandem arrays of repetitive elements in large segments are called satellite (Sat) sequences, a term initially derived from the specific mobility of repetitive DNA sequences in differential gradient centrifugation [2]. Sat DNA is generally classified by (i) size of the repeated unit, (ii) sequence composition and (iii) length of the array. Their first classification distinguished microsatellites (1–5 bp repeat units), minisatellites (6–100 bp per unit), midisatellites (101–400 bp) and macrosatellites (>401 bp) [3–6]. Since then, the classification has been simplified and is summarized in Table 1.

Table 1
Different classes of human satellite sequences
 Repeat unit length (bp) Size of the array Localization Characteristics Fraction of the genome Non-malignant disease 
Satellites 5–200 100 kb to several Mb Mostly (peri)centromeric regions of all chr.  3%  
α satellites 171 100 kb to Mb All human centromeres - Organized in Higher Order Repeats (HOR) with chr. specificity (2–30 repeats)
- Each HOR is repeated up to several hundred times
- AT-rich/two methylatable CpGs 
2.58% - Hypomethylated in ICF2, 3, 4 patients
- Associated with chr. instability 
β satellites 68 50–300 kb - Short arm of acrocentric chr.
- Pericentromeres chr. 1, 3 and 9
- Long arm of chr. Y 
- Polymorphic and chr. specific
- Spans transitions from euchromatin to heterochromatin on chr. 1, 3, 9 and Y and acrocentric chr. 
0.02% Part of a complex repeat-unit (D4Z4) deleted in FSHD 
γ satellites 220 14–75 kb Centromeres of chr. 8, Y Conserved motifs: TCAGGGGGACGTTGAGGCAG and (G/C)AGG 0.13% NA 
Satellite 1 42 11––70 kb - Pericentromeres of chr. 3, 4
- Short arm of acrocentric chrs. between centromere and rDNA sequences 
AT-rich
ACTTTC/GATATTTTATGT + ACAAGTATATAATA(C/T)A(C/T)ATTTTGGGT motifs 
0.12% NA 
Satellite 2 100 kb to 18 Mb - Presumably at all pericentromeres
- Large heterochromatin pericentromeric blocks on chr. 1 and 16
- Minor sites at pericentromeres of chr. 2 and 10 
CGAATGGAAT)2 + (CAT) 1 or 2 motifs 1.5% - Hypomethylated in all ICF patients leading to decondensation of heterochromatin blocks
- Associated with chr. instability 
Satellite 3 500 kb to 15 Mb - Large heterochromatin pericentromeric block on chr. 9
- Pericentromere chr. 10 
(GGAAT)n ± CAACCCGA(C/A)T motif 1.5%  
Minisatellites 6–100  Generally euchromatic Throughout the genome 1%  
VNTRs 9–24 1–5 kb Mostly euchromatic - More than 1000 locations
- Highly polymorphic but common motif GGGCAGGANG 
  
Telomere Up to 10kb Heterochromatin-like organization (TTAGGG)n at all chromosome ends  Shortening of repeat arrays in aging and age-related diseases 
Microsatellites 1–7   Throughout the genome 3%  
 Mostly two to three lettered motifs <100 bp Mostly euchromatic   Expansion of triplet repeats in over 15 human neurological and neuromuscular diseases 
 Repeat unit length (bp) Size of the array Localization Characteristics Fraction of the genome Non-malignant disease 
Satellites 5–200 100 kb to several Mb Mostly (peri)centromeric regions of all chr.  3%  
α satellites 171 100 kb to Mb All human centromeres - Organized in Higher Order Repeats (HOR) with chr. specificity (2–30 repeats)
- Each HOR is repeated up to several hundred times
- AT-rich/two methylatable CpGs 
2.58% - Hypomethylated in ICF2, 3, 4 patients
- Associated with chr. instability 
β satellites 68 50–300 kb - Short arm of acrocentric chr.
- Pericentromeres chr. 1, 3 and 9
- Long arm of chr. Y 
- Polymorphic and chr. specific
- Spans transitions from euchromatin to heterochromatin on chr. 1, 3, 9 and Y and acrocentric chr. 
0.02% Part of a complex repeat-unit (D4Z4) deleted in FSHD 
γ satellites 220 14–75 kb Centromeres of chr. 8, Y Conserved motifs: TCAGGGGGACGTTGAGGCAG and (G/C)AGG 0.13% NA 
Satellite 1 42 11––70 kb - Pericentromeres of chr. 3, 4
- Short arm of acrocentric chrs. between centromere and rDNA sequences 
AT-rich
ACTTTC/GATATTTTATGT + ACAAGTATATAATA(C/T)A(C/T)ATTTTGGGT motifs 
0.12% NA 
Satellite 2 100 kb to 18 Mb - Presumably at all pericentromeres
- Large heterochromatin pericentromeric blocks on chr. 1 and 16
- Minor sites at pericentromeres of chr. 2 and 10 
CGAATGGAAT)2 + (CAT) 1 or 2 motifs 1.5% - Hypomethylated in all ICF patients leading to decondensation of heterochromatin blocks
- Associated with chr. instability 
Satellite 3 500 kb to 15 Mb - Large heterochromatin pericentromeric block on chr. 9
- Pericentromere chr. 10 
(GGAAT)n ± CAACCCGA(C/A)T motif 1.5%  
Minisatellites 6–100  Generally euchromatic Throughout the genome 1%  
VNTRs 9–24 1–5 kb Mostly euchromatic - More than 1000 locations
- Highly polymorphic but common motif GGGCAGGANG 
  
Telomere Up to 10kb Heterochromatin-like organization (TTAGGG)n at all chromosome ends  Shortening of repeat arrays in aging and age-related diseases 
Microsatellites 1–7   Throughout the genome 3%  
 Mostly two to three lettered motifs <100 bp Mostly euchromatic   Expansion of triplet repeats in over 15 human neurological and neuromuscular diseases 

Abbreviations: bp, base-pair; chr., chromosome; kb, kilobase; ICF, Immunodeficiency with Centromeric instability and Facial anomalies syndrome; Mb, megabase; VNTR, variable number of tandem repeat.

Although they represent only 10–15% of the human genome, large arrays of Sat repeats define specialized chromosomal loci. The most prominent examples include telomeres, which protect the end of the chromosomes from deterioration or fusion with other chromosomes [7], and centromeres, which are essential for faithful chromosome segregation during cell division [8]. Sat DNA, at least in part through the repressive epigenetic marks that they carry, also underlie the assembly of heterochromatin at specialized domains such as pericentromeres and subtelomeres, but also at more discrete intergenic loci. They organize repressive heterochromatin compartments in the nuclear space [9], and in turn, favor the partition between active and repressed chromatin [10]. Sat DNA also appears to be central to genome stability as inferred from their loss of integrity observed in cancer [11] and further demonstrated in different animal models [10–13]. They also represent useful and proven genetic markers with varied applications [14]. We will focus here on the different classes of Sat repeats, their epigenetic control and discuss examples of genetic diseases where their loss of integrity has been shown to be causative.

DNA methylation and repression of DNA repeats

Repetitive sequences represent a substantial threat to genome stability and a source of genomic rearrangement as they are prone to homologous recombination. Sat repeats are also transcriptionally competent, although at low levels in normal somatic cells. The resulting RNAs participate in the assembly of specialized chromatin complexes at their loci of origin [8,15–18]. In turn, unscheduled transcription or accumulation of Sat transcripts has been reported in physiopathological cases that include stress [19], aging [20] or cancer [21] and largely correlates with reduced DNA methylation (DNAme), especially in cancer where genome-wide hypomethylation (HypoMe) has been suggested as a key step of carcinogenesis [22].

DNAme, the covalent attachment of a methyl group to cytosine residues, occurs mainly within a CpG context in mammals, and constitutes an epigenetic mark that is essential for the normal establishment of developmental programs [23–26]. In addition to the well-known transcriptional repression, DNAme has been implicated in most biological processes [27]. DNAme is dynamic during development, catalyzed by de novo DNA methyltransferases (DNMT) 3A and 3B and subsequently copied by the maintenance DNMT1 from a hemi-methylated template during DNA replication [26]. DNAme is not homogeneous across the genome, owing in part to the global depletion in CpG dinucleotides in mammals, with the notable exception of repetitive elements and CpG islands (CGI) present at the promoter regions of 60% of all human genes [28]. Strikingly, genome-wide mapping studies have revealed that CGI are remarkably unmethylated in most cellular contexts, whereas the bulk of the genome is mostly methylated in somatic tissues [29]. With half of the human genome being made of repetitive elements with a relative enrichment in CpGs, an important consequence is that the majority of methylated sites maps to DNA repeats in somatic cells, in contrast with germ [30], pluripotent [31] and cancer cells [22,32]. Consequently, the evaluation of DNAme of repetitive DNA sequences is often used as a proxy to estimate the global methylation state of a given cell type or tissue. Another important issue is that the non-random nature of DNAme profiles implies that the DNAme machinery must be guided to specific genomic locations. In addition to CpG content, chromatin marks like histone methylation or transcription factors were proposed to shape DNAme patterns by promoting or preventing the recruitment of DNMTs at specific CpGs [33].

At DNA repeats, DNAme contributes to genome protection from transposition and mitotic recombination [27]. It may also contribute to prevent illicit transcription and accumulation of toxic RNAs but causal links are still missing. Yet, DNAme appears to be a major mechanism for genome maintenance.

Different classes of satellite DNA with links to diseases

Microsatellites

The high level of polymorphism in microsatellite [Short Tandem Repeats (STRs); Simple Sequence Repeats (SSRs)] length contributes to quantitative human traits and has been used for many years in genome mapping, population genetics studies and forensics. Microsatellite arrays are altered during DNA replication due to slippage resulting from misaligned strands, formation of secondary hairpin structures and defects in DNA repair during DNA synthesis [34–36]. STRs substantially contribute to the heritability and variability in gene expression. Their polymorphisms impact DNA accessibility to transcription factors, spacing between promoter elements and enhancers, alternative splicing, mRNA stability, selection of transcription start and termination sites, generation of non-coding RNA instead of a coding mRNA or represent hotspots for meiotic recombination [37–41], reviewed in [42]. At the chromatin level, STRs have been involved in changes in DNAme, nucleosome positioning or higher order chromatin conformation possibly involving DNA looping through interactions between distant elements [43].

Dinucleotide repeats are the most frequent STRs in the human genome. They often exhibit polymorphism length with impact on gene expression due, at least in part, to their potential to form alternative DNA structures [44]. Aberrant microsatellite polymorphisms have been associated with diseases, although clear associations remain limited relative to their abundance in the human genome. For example, expanded repeated (GT)n dinucleotide in the promoter region of the HMOX1 (Heme Oxygenase 1) is associated with a higher risk of cardiovascular disease, cancer, preeclampsia and Parkinson’s disease [45–47]. Likewise, gain or loss of a single AC dinucleotide in the (GT)5-AC-(GT)5-AC-(GT)9-10 repeat causes changes in the promoter activity of the SLC11A1 (or NRAMP1; Natural Resistance-Associated Macrophage Protein 1) gene and a several-fold increase in gene expression [48]. Owing to their richness in CG dinucleotides, poly-CG repeats influence local DNAme with consequences on nucleosome positioning, DNA conformation or transcription factors binding [49,50]. Although CGI are rarely methylated, CGI methylation at promoters leads to gene silencing and impact gene expression.

Consequences of microsatellite expansion in epigenetic regulation and diseases

Other examples include the pathological expansion of STRs, trinucleotides in most cases, in a number of human genetic neurological or neuromuscular diseases. These unstable repeats are prone to expansion during intergenerational transmission, but are also unstable in somatic cells. The increased number of these repeats above a certain threshold alters the expression of the affected gene or the function of its protein product. The list of these diseases has grown over the years and includes Myotonic Dystrophy (DM), Huntington’s disease (HD) or Fragile X syndrome (FXS) among others (Figure 1).

Schematic representation of regions containing microsatellite expansions

Figure 1
Schematic representation of regions containing microsatellite expansions

Short expansion of microsatellites corresponding to the nucleotides triplets, or tetra, penta, hexanucleotides have been observed in coding or non-coding regions with different consequences on RNA production, conformation or stability in coding region or protein function and gene regulation when mutation occurs in the 5′ or 3′UTR of genes. A number of genetic neurological or neuromuscular diseases have been linked to microsatellite expansions such as Fragile X syndrome (FXS), Huntington’s disease (HD), Friedreich’s ataxia (FRDA) or type 1 Myotonic Dystrophy (DM1). Genes implicated for the different syndromes are indicated: FMR1, HTT, FXN (Frataxin) and DMPK respectively. For these four diseases, the expanded triplet is indicated in bold, CGG for FXS, CAG for HD, GAA for FRDA, CTG for DM1. For these four diseases, the consequences of triplet expansion on chromatin structure is indicated.

Figure 1
Schematic representation of regions containing microsatellite expansions

Short expansion of microsatellites corresponding to the nucleotides triplets, or tetra, penta, hexanucleotides have been observed in coding or non-coding regions with different consequences on RNA production, conformation or stability in coding region or protein function and gene regulation when mutation occurs in the 5′ or 3′UTR of genes. A number of genetic neurological or neuromuscular diseases have been linked to microsatellite expansions such as Fragile X syndrome (FXS), Huntington’s disease (HD), Friedreich’s ataxia (FRDA) or type 1 Myotonic Dystrophy (DM1). Genes implicated for the different syndromes are indicated: FMR1, HTT, FXN (Frataxin) and DMPK respectively. For these four diseases, the expanded triplet is indicated in bold, CGG for FXS, CAG for HD, GAA for FRDA, CTG for DM1. For these four diseases, the consequences of triplet expansion on chromatin structure is indicated.

The FXS (OMIM # 300624) is caused by the amplification of a CGG repeat in the 5′ UTR of the FMR1 (Fragile X Mental Retardation; Xq28) gene, which encodes an RNA-binding protein important for neuronal development and synaptic plasticity. In healthy individuals, this CGG repeat is polymorphic in length, with 30 repeats for the most common allele, often punctuated by AGG interruptions [51]. Alleles with longer perfect CGG repeat tracts, not interrupted by AGG repeats, are prone to expansion. These expansions lead to premutated alleles containing between 55 and 200 triplets. Males carrying these premutations are at risk for developing fragile X-associated tremor/ataxia syndrome (FXTAS, OMIM # 300623), whereas females have an increased likelihood of developing fragile X-associated primary ovarian insufficiency (FXPOI, OMIM #311360). Pre-mutated alleles are unstable and may expand to a full mutation during meiosis. In FXS patients, expansion of the CGG triplet, which contains a methylatable CpG, over 200 copies are associated with hypermethylation of the FMR1 gene promoter leading to its silencing [52–54].

Another expansion triplet disease, Friedreich’s Ataxia (FRDA, OMIM # 229300), is linked to GAA expansion in exon 1 of the FXN (Frataxin; 9q21.1) gene, which encodes a protein involved in the regulation of mitochondrial iron transport. Healthy individuals carry trinucleotide tracts of more than 40 repeats. The pathological threshold reaches 70, with 600 and 900 triplets commonly found in FRDA patients. The formation of R-loops, i.e. hybrids between DNA and the transcribing RNA, at expanded GAA site are thought to result in stalling of the RNA polymerase and premature transcription termination [55]. At the chromatin level, GAA expansions are associated with local depletion in nucleosomes and cause variegating expression of nearby genes through bidirectional increase in DNAme and compaction of the locus into heterochromatin [56]. DNAme is inversely correlated with FXN expression and disease onset, suggesting a major role for epigenetic changes in the disease severity [55,57].

Furthermore, with nearly all disease-associated STRs located at CpG-rich chromatin boundaries that functionally separate chromatin domains, STRs’ expansions have been proposed as hotspots for epigenetic misregulation or topological disruption [58,59], highlighting a key role for repetitive elements in the regulation of the genome architecture.

Satellite repeats

Sat repeats represent approximately 3% of the human genome [1] and are divided into six families: 1 to 3 and α to γ (Table 1).

α satellites (α-Sat) represent the major class of tandem repeats. They are found in all human centromeres where the 171 bp repeat units, which are 50–70% identical, are arranged tandemly in a head-to-tail fashion. A defined number of monomers create a higher order repeat (HOR) unit with a chromosome-specific organization and composition [60–62] (Figure 2A). However, these sequences are not conserved and are not sufficient to genetically define centromeres. Instead, the replacement of canonical histone H3 by its centromere-specific variant CENP-A in a subset of centromeric nucleosomes serves as a key epigenetic determinant of centromere identity and kinetochore assembly, through the generation of a unique chromatin environment [63]. α-Sat repeats contain two to three methylatable CpGs, two of which being in the consensus sequence for the binding of CENP-B, another key determinant of centromere function [64], although the link between DNAme and CENP-B occupancy is still debated [65].

HypoMe of (peri)centromeric satellite tandem repeats in the ICF syndrome

Figure 2
HypoMe of (peri)centromeric satellite tandem repeats in the ICF syndrome

(A) Tandem repeats of α-Sat (240 kb to 5 Mb of 171 bp units) form the centromere (green arrows) of all human chromosomes with sequence specificity on each chromosome. At centromeres, the histone variant CENP-A replaces canonical histone H3 in a subset of nucleosomes. Satellite type 2 and 3 (red arrows) are made of a 5-bp repeat unit unevenly distributed over up to several megabases, where they form larger heterochromatin blocks in pericentromeric regions of certain chromosomes (1, 9, 16 and heterochromatin of chromosome Y), marked by the presence of repressive histone mark tri-methylated lysine 9 of histone H3 (H3K9me3) and the heterochromatin proteins HP1 among others. These repeats are constitutively methylated in somatic cells. Black lollipops represent methylated CpGs (not representative of density which is higher in pericentric regions). (B) All ICF patients show HypoMe of Sat-2 and 3 repeats (red arrows with white lollipops), but patients with mutations in ZBTB24, CDCA7 or HELLS show additional HypoMe of centromeric α-satellite repeats (green arrows with white lollipops). Putative consequences of (peri)centromeric repeats HypoMe are indicated below, which could lead to the observed chromosomal instability (formation of typical radial figures that involve chr. 1, 9, and 16), chromosome breaks and rearrangements). Altered nuclear heterochromatin organization may also have indirect and global impact on gene expression through the delocalization of loci normally repressed by proximity to these repressive compartments). Abbreviation: ICF, Immunodeficiency with Centromeric instability and Facial anomalies syndrome.

Figure 2
HypoMe of (peri)centromeric satellite tandem repeats in the ICF syndrome

(A) Tandem repeats of α-Sat (240 kb to 5 Mb of 171 bp units) form the centromere (green arrows) of all human chromosomes with sequence specificity on each chromosome. At centromeres, the histone variant CENP-A replaces canonical histone H3 in a subset of nucleosomes. Satellite type 2 and 3 (red arrows) are made of a 5-bp repeat unit unevenly distributed over up to several megabases, where they form larger heterochromatin blocks in pericentromeric regions of certain chromosomes (1, 9, 16 and heterochromatin of chromosome Y), marked by the presence of repressive histone mark tri-methylated lysine 9 of histone H3 (H3K9me3) and the heterochromatin proteins HP1 among others. These repeats are constitutively methylated in somatic cells. Black lollipops represent methylated CpGs (not representative of density which is higher in pericentric regions). (B) All ICF patients show HypoMe of Sat-2 and 3 repeats (red arrows with white lollipops), but patients with mutations in ZBTB24, CDCA7 or HELLS show additional HypoMe of centromeric α-satellite repeats (green arrows with white lollipops). Putative consequences of (peri)centromeric repeats HypoMe are indicated below, which could lead to the observed chromosomal instability (formation of typical radial figures that involve chr. 1, 9, and 16), chromosome breaks and rearrangements). Altered nuclear heterochromatin organization may also have indirect and global impact on gene expression through the delocalization of loci normally repressed by proximity to these repressive compartments). Abbreviation: ICF, Immunodeficiency with Centromeric instability and Facial anomalies syndrome.

α-Sat are also found in pericentromeric regions where they can be interspersed with divergent monomers, transposable elements and other types of satellite DNA [66] (Figure 2A). On certain chromosomes, these satellite repeats from larger domains that are visible in cytogenetics like satellite 1 (Sat-1) on acrocentric chromosomes [62], and satellite 2 (Sat-2) and satellite 3 (Sat-3), most notably on chromosomes 1, 9, and 16 [67]. At the molecular level, pericentromeric regions have hallmarks of heterochromatin, a packed form of chromatin enriched in DNAme and tri-methylated lysine 9 of histone H3 (H3K9me3) [68]. Pericentromeric heterochromatin (PCH) accounts for the majority of constitutive heterochromatin of the human genome and forms subnuclear compartments in interphase that have been implicated in long-range transcriptional silencing [9,69]. Evidence from diseases like cancer or the ICF syndrome (see below) established that the epigenetic state of heterochromatin participates in the stabilization of repetitive sequences and inhibition of recombination between repeats, including at centromeres, and maintenance of nuclear organization [70–72].

DNAme and peri-centromeric satellite repeats in the ICF syndrome

The Immunodeficiency with Centromeric instability and Facial anomalies syndrome (ICF) is an extremely rare autosomal recessive immunological/neurological disorder, but represents a remarkable case where constitutive defects in DNAme that affect satellite repeats are directly linked to chromosomal instability (reviewed in [73]). The invariant chromosomal instability includes the presence of unusual multiradial chromosomal figures, decondensation and rearrangement of PCH of chromosomes 1, 16 and sometimes 9, which serves for diagnosis [74] and is caused by DNAme loss at Sat-2 and Sat-3 pericentromeric repeats, respectively [75]. HypoMe was also reported in facultative heterochromatin on the inactive X-chromosome (Xi) in female patients [76], in GC-rich subtelomeric repeats [77], and at NBL2 (SST1) and D4Z4 macrosatellites [78].

Mutations in DNMT3B (ICF1; OMIM 242860) explain half of the patients [25,79,80]. In the remainder, additional HypoMe of centromeric α-Sat-repeats indicated genetic heterogeneity [76,81]. Indeed, exome sequencing identified mutations in ZBTB24 (ICF2; OMIM 614069) [82], CDCA7 (ICF3; OMIM 609937) and HELLS (ICF4; OMIM 603946) [83]. These factors are transcription factors (ZBTB24, CDCA7) or chromatin remodeler (HELLS) with very few known functions but strikingly devoid of DNMT activity. Although they are required for DNAme maintenance at murine centromeric repeats [83], their functional links with the DNAme machinery remain to be established and have been discussed elsewhere [84]. Recent methylome analysis revealed that ICF1 patients have DNAme defects mostly distinct from those of ICF2-4 [85], except for their common HypoMe of Sat-2 repeats and Xi in females. Hence, the question of how HypoMe of satellite repeats contributes to clinical signs is still open (Figure 2B).

An important widely conserved feature of (peri)centromeric repeats is that their transcription and their derived transcripts are tightly linked to centromere identity and function [15,86]. Pathological DNAme loss at satellite repeats could lead to the accumulation of satellite transcripts, as observed in cancer cells [21], which have been causally implicated in centromere disassembly and chromosomal instability [87,88]. An aberrant accumulation of repeat transcripts may also have global impact on nuclear functions through the sequestration of proteins away from their site of action. Increased transcription through tandem repeats is likely to promote the formation of detrimental secondary structures [89], abnormal recombination between repeat units [90] and alterations of the specific centromeric chromatin on which relies the recruitment of kinetochore proteins required for faithful chromosome segregation [87,91,92]. Increased DNA damage at satellite repeats following transcription-dependent formation of secondary structures, loss of DNAme or mutations in ICF factors recently implicated in DNA repair pathways [93] may also contribute to the observed chromosomal instability.

Although local changes in DNAme at gene promoters or gene bodies can directly impact their transcription, indirect mechanisms may also lead to global alterations of DNAme patterns and gene expression downstream of ICF mutations. This includes the already proposed changes in replication timing [94,95] and in splicing [96]. In addition, HypoMe and decondensation of constitutive PCH is known to alter the organization of nuclear heterochromatin [97], where a number of loci are maintained in a silent state [9]. Hence, gene derepression may originate from the disorganization of PCH compartments reputed to be repressive for transcription. Interestingly, ZBTB24 is recruited to PCH while its mutant version is delocalized in ICF2 cells [98]. Hence, it is tempting to speculate that ZBTB24 may orchestrate PCH formation and coordinate DNAme/repression at multiple target loci through their recruitment close to repressive heterochromatin compartments.

Yet, all these mechanisms do not explain why only certain tissues, like lymphocytes and brain, are affected by Sat-2 HypoMe in a context where the decrease in DNAme applies to all tissues in all patients. All ICF factors are expressed at the earliest stages of development, at least in the mouse (Transcriptome in Mouse Early Embryos; http://dbtmee.hgc.jp/), and are relatively ubiquitously expressed in adult tissues, although at low levels, with apparent enrichment in lymphocytes, brain or testis (The Human Protein Atlas; www.proteinatlas.org/). This is compatible with the observed clinical signs and implies that tissue-specific factors or cellular contexts create a favorable environment for molecular defects downstream of DNAme loss at Sat-2 repeats, which is the most prominent unifying feature in all ICF patients, possibly through their transcriptional derepression. Along these lines, ZBTB24 mutations in a Zebrafish model lead to an interferon-based innate immune response triggered by the RNA-sensing machinery [99].

Macrosatellites

Macrosatellites are large and highly polymorphic GC-rich tandemly repeated sequences often localized in the vicinity of heterochromatic regions [100]. With a unit size comprising between 1.5 and 38.8 kb, these elements usually span between 50 and 100 kb of genomic DNA [100]. Macrosatellites, present on a limited number of chromosomal regions are considered as the largest Variable Number Tandem Repeats (VNTRs) and probably the most polymorphic sequences in the human genome [100,101]. Their number is likely underestimated because, at least in part, of their repetitive nature that hampers their correct annotation [102]. Furthermore, their function in genome biology remains unclear and poorly studied except for a few of them [100,101,103,104] for which a correlation between macrosatellite copy number, epigenetic changes and expression of genes outside of these VNTRs have been reported [101,102,105–107]. For instance, a direct correlation between MSat10 or MSat12 copy number, increase in DNAme or H3K9me3 and ZFP37 or ZNF558 gene expression has been documented [102]. Another macrosatellite on the X chromosome, DXZ4, is regulated by dosage compensation mechanisms. DXZ4 has hallmarks of heterochromatin on the male and female active X chromosome [105,108]. In contrast, DXZ4 adopts a euchromatic conformation on the Xi and is bound by the CTCF insulator-binding factor in female cells. Thus, lying at the junction between active and repressed chromatin compartments, DXZ4 is thought to play a key role in the X chromosome architecture [109–112]. In contrast, the number of copies of the small U2 nuclear RNA (RNU2) macrosatellite close to the breast cancer susceptibility gene, BRCA1 [113] is not associated with changes in DNAme or expression [114], indicating diverse impact of these large repetitive sequences across the human genome.

D4Z4 and facioscapulohumeral dystrophy

Facioscapulohumeral muscular dystrophy (FSHD) is the third most common form of inherited neuromuscular disorders with an estimated prevalence of 1:8000 to 1:20000 [115,116]. This autosomal dominant inherited disorder is characterized by progressive muscle weakness of specific groups of muscles [117]. At the molecular level, more than 95% of cases are linked to the deletion of integral copies of a tandemly repeated 3.3 kb macrosatellite repeat (D4Z4) at the subtelomeric 4q35 locus (FSHD1, OMIM #158900, Figure 3A,B). This rearrangement is thought to occur via intrachromosomal rearrangements and sister chromatin exchange [118].

Schematic representation of the 4q35 subtelomeric locus

Figure 3
Schematic representation of the 4q35 subtelomeric locus

(A) The D4Z4 repetitive array (gray arrows) is located at a distance of ∼20 kb from the telomere, lying at the end of the 4q chromosome arm (yellow arrows). In healthy individuals, the number of repeats comprises between 11 and 75 D4Z4 copies, with a mean size of 108.9 kb (33 units) in the general population [126]. Telomeric to D4Z4, two types of alleles (qA and qB), equally common in the population have been identified. A third less common allele (type C) has also been reported. Upstream of the first D4Z4 repeat, simple sequence length polymorphisms (SSLP) have been reported (4qA161; 4qA163; 4qA166; 4qB161; 4qB163; 4qB162; 4qB164; 4qB166; 4qB168) present at different frequencies in the population [127]. FSHD has been mainly associated with the 161 SSLLP corresponding to a (CA)10-AA-(CA)10-G-(CT)6 microsatellite. (B) In FSHD1 patients, the D4Z4 array is shortened below a threshold of 11 units. This shortening mainly occurs on type A haplotypes, which mostly differ from B-type alleles by the presence of a 260-bp sequence called pLAM and containing a degenerated polyadenylation site (ATTAAA). This sequence is followed by an array of β satellite elements of up to 7.5 kb in size. (C) In FSHD2 patients, the size of the D4Z4 array is identical with healthy individuals (>11 units). The majority of these patients display HypoMe of the D4Z4 repeats associated with mutation in the SMCHD1 gene. These patients also carry a type-A allele and the proximal 161 SSLP. (D) Schematic representation of the D4Z4 array and identification of regions with a reduced level of methylation identified by Southern blot after digestion of the FseI enzyme for the first D4Z4 unit with an average decrease of 15–20% in FSHD1 patients and of 35% in FSHD2 patients compared with controls. Different sequences have been analyzed by bisulfite sequencing (primers are indicated) revealing a decrease of 20% in FSHD1 patients compared with controls and a level of methylation <30% in FSHD2 patients.

Figure 3
Schematic representation of the 4q35 subtelomeric locus

(A) The D4Z4 repetitive array (gray arrows) is located at a distance of ∼20 kb from the telomere, lying at the end of the 4q chromosome arm (yellow arrows). In healthy individuals, the number of repeats comprises between 11 and 75 D4Z4 copies, with a mean size of 108.9 kb (33 units) in the general population [126]. Telomeric to D4Z4, two types of alleles (qA and qB), equally common in the population have been identified. A third less common allele (type C) has also been reported. Upstream of the first D4Z4 repeat, simple sequence length polymorphisms (SSLP) have been reported (4qA161; 4qA163; 4qA166; 4qB161; 4qB163; 4qB162; 4qB164; 4qB166; 4qB168) present at different frequencies in the population [127]. FSHD has been mainly associated with the 161 SSLLP corresponding to a (CA)10-AA-(CA)10-G-(CT)6 microsatellite. (B) In FSHD1 patients, the D4Z4 array is shortened below a threshold of 11 units. This shortening mainly occurs on type A haplotypes, which mostly differ from B-type alleles by the presence of a 260-bp sequence called pLAM and containing a degenerated polyadenylation site (ATTAAA). This sequence is followed by an array of β satellite elements of up to 7.5 kb in size. (C) In FSHD2 patients, the size of the D4Z4 array is identical with healthy individuals (>11 units). The majority of these patients display HypoMe of the D4Z4 repeats associated with mutation in the SMCHD1 gene. These patients also carry a type-A allele and the proximal 161 SSLP. (D) Schematic representation of the D4Z4 array and identification of regions with a reduced level of methylation identified by Southern blot after digestion of the FseI enzyme for the first D4Z4 unit with an average decrease of 15–20% in FSHD1 patients and of 35% in FSHD2 patients compared with controls. Different sequences have been analyzed by bisulfite sequencing (primers are indicated) revealing a decrease of 20% in FSHD1 patients compared with controls and a level of methylation <30% in FSHD2 patients.

The remaining 5% of patients do not display this shortened repetitive array (FSHD2, OMIM #158901, Figure 3C) and a significant subset of them are carrier of a mutation in the SMCHD1 gene encoding the Structural Maintenance Of Chromosomes Flexible Hinge Domain-Containing Protein 1 [119]. Interestingly, monosomy of the 4qTer locus is not associated with FSHD, indicating that at least one copy of the macrosatellite is required as a trigger for the disease [120]. D4Z4 is highly enriched in CpG dinucleotides (70%) that are hypomethylated in some specific regions within the repeat, upstream of the promoter region of the DUX4 retrogene that is encoded by the repeat [121–123].

The FSHD locus displays a complex organization and additional features have been associated with the disease (Figure 3). In the vast majority if not all patients (FSHD1 and FSHD2), the clinical phenotype segregates with the presence of a type A haplotype, distal to the last repeat [124]. A-type alleles are characterized by the presence of a polyadenylation site distal to the last D4Z4 repeat, which is required for the stabilization of the DUX4 transcript that originates from the last unit and which is ectopically activated in patients [125]. Type A allele, which is not fully annotated in the human genome, displays some variations in size and sequence and contains a 6–7.5 kb region enriched in β satellite elements (Table 1) between the last D4Z4 repeat and the telomere [124,126]. In addition, 3.5 kb upstream of the first D4Z4 repeat, several Single Site Length Polymorphisms (SSLPs) have been described with nine different haplotypes identified for the 4q35 and 10q26 chromosomes, which is 98% identical with the 4q35 [127]. FSHD has been associated with the 161 SSLP, termed as permissive haplotype [127]. However, whether and how these microsatellites contribute to the disease remains unknown.

The current prominent model to explain FSHD is based on the postulate that shortening of the D4Z4 array in FSHD1, or mutations in the SMCHD1 chromatin-associated factor in FSHD2, leads to the relaxation of D4Z4 chromatin and activation of the DUX4 retrogene encoded by the last D4Z4 unit and abutting so-called pLAM sequence, which contains a polyadenylation site required for stabilization of the transcript [125]. However, this model is being challenged by the findings that D4Z4 is hypomethylated and competent for DUX4 transcription in unrelated diseases with absence of muscular phenotype such as Bosma Arhinia and Microphtalmia syndrome (BAMS, OMIM #603457) caused by SMCHD1 mutations [123,128,129], ICF syndrome (OMIM #242860) caused by mutations in DNMT3B [130], or in patients with an 18p deletion syndrome in which the deletion of short arm of chromosome 18 encompasses SMCHD1 [130]. Moreover, the DUX4 transcript was found to be detectable in these different syndromes [123,130,131], as well as in healthy muscle biopsies or in other tissues [132,133], questioning its role in the pathogenesis and leaving open the question on the tissue and muscle type specificity in FSHD (Figure 3).

Interestingly, as for D4Z4 [122,123], a bimodal distribution of DNAme with coexistence of regions subjected to methylation changes and regions in which methylation remains identical regardless of the genetic context (Figure 3D), exists for other macrosatellites such as RS447 [103], DXZ4 [105,106] or RNU2 [134]. Furthermore, D4Z4 is involved in the long-range organization of the 4q35 locus [135–138] and bound by CTCF upon shortening of the array. Besides coding the DUX4 protein required for the Zygotic Genome Activation (ZGA) stage [139,140], D4Z4 also encodes different sense and antisense transcripts [141] and the DBE-T long non-coding RNA [142], a feature also observed for other macrosatellites [143]. In addition, D4Z4 acts as a chromatin boundary able to partition the 4q35 subtelomere into functional domains [135–137,144]. Another feature reminiscent of what has been described for DXZ4, which is also regulated by SMCHD1 [145–147] reinforcing the hypothesis of common mode of regulation and a role for macrosatellites in the organization of the genome.

Concluding remarks

For a long time, repetitive DNA sequences have been largely ignored in functional genomic studies. Over time, it became obvious that these sequences play key roles at different levels of the regulation of the human genome, but are also associated with a number of pathologies or susceptibility to diseases. Tandem repeats play important functional roles in genome biology and evolution, with functional impact either locally on flanking regions or over long distances. Over the last decade, deep sequencing methods have been very useful for the functional annotation of epigenetic marks across the genome. However, non-unique reads, especially those corresponding to VNTRs, are usually discarded from these analyses leaving large gaps on corresponding genome representations. Nevertheless, the thousands of tandem repeat variants scattered across the human genome likely modify the chromatin landscape and exert functional effects via local but also long distance epigenetic changes. Thus, variegation in gene expression likely accounts for a large part of the missing heritability, variations in human phenotypes and susceptibility to diseases. In the near future, recent deep-sequencing methodologies permitting long read sequencing if combined to chromosomal localization of these regions by pulse field gel electrophoresis (PFGE; [100], Fiber-FISH [148,149] or molecular combing [150–152], will likely prove fruitful to complete the current genome assembly and facilitate the understanding of this complex portion of the human genome.

Summary

  • Tandemly repeated sequences represent the largest pool of methylated cytosines of the human genome.

  • Repetitive DNA sequences contribute to the epigenetic regulation of the human genome.

  • Micro to macro satellite sequences contribute to the topological organization of the human genome.

  • Alteration in the number and epigenetic profile of satellite DNA elements are associated with genome evolution and disease susceptibility.

Acknowledgments

The authors acknowledge members of their respective laboratories for constructive comments.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the Institut National de la Recherche Médicale and Fondation Maladies Rares (to C.F. and F.M.); and the work in F.M.’s lab is funded by AFM-Telethon [grant number TRIM-RD].

Author Contribution

Both authors wrote and edited the manuscript and figures.

Abbreviations

     
  • α-Sat

    α satellite

  •  
  • CENP

    Centromeric Protein

  •  
  • CGI

    CpG island

  •  
  • CpG

    Cytosine-Guanine dinucleotide

  •  
  • CTCF

    CCCTC-binding factor

  •  
  • DNAme

    DNA methylation

  •  
  • DNMT

    DNA methyltransferase

  •  
  • FMR1

    Fragile X Mental Retardation

  •  
  • FXS

    Fragile X syndrome

  •  
  • FRDA

    Friedreich’s ataxia

  •  
  • FSHD

    facioscapulohumeral muscular dystrophy

  •  
  • FXN

    Frataxin

  •  
  • HypoMe

    hypomethylation

  •  
  • H3K9me3

    tri-methylated lysine 9 of histone H3

  •  
  • ICF

    Immunodeficiency with Centromeric instability and Facial anomalies syndrome

  •  
  • PCH

    pericentromeric heterochromatin

  •  
  • RNU2

    small U2 nuclear RNA

  •  
  • Sat

    satellite

  •  
  • SMCHD1

    Structural maintenance of chromosomes flexible hinge domain containing 1

  •  
  • SSLP

    single site length polymorphism

  •  
  • STR

    short tandem repeat

  •  
  • VNTR

    variable number of tandem repeat

  •  
  • Xi

    inactive X-chromosome

References

References
1.
Lander
E.S.
,
Linton
L.M.
,
Birren
B.
,
Nusbaum
C.
,
Zody
M.C.
,
Baldwin
J.
et al. .
(
2001
)
Initial sequencing and analysis of the human genome
.
Nature
409
,
860
921
,
[PubMed]
2.
Wolfe
J.
,
Darling
S.M.
,
Erickson
R.P.
,
Craig
I.W.
,
Buckle
V.J.
,
Rigby
P.W.
et al. .
(
1985
)
Isolation and characterization of an alphoid centromeric repeat family from the human Y chromosome
.
J. Mol. Biol.
182
,
477
485
,
[PubMed]
3.
Jeffreys
A.J.
,
Wilson
V.
and
Thein
S.L.
(
1985
)
Hypervariable ‘minisatellite’ regions in human DNA
.
Nature
314
,
67
73
,
[PubMed]
4.
Tautz
D.
and
Schlotterer
C.
(
1994
)
Simple sequences
.
Curr. Opin. Genet. Dev.
4
,
832
837
,
[PubMed]
5.
Vergnaud
G.
and
Denoeud
F.
(
2000
)
Minisatellites: mutability and genome architecture
.
Genome Res.
10
,
899
907
,
[PubMed]
6.
Jeffreys
A.J.
,
Allen
M.J.
,
Armour
J.A.
,
Collick
A.
,
Dubrova
Y.
,
Fretwell
N.
et al. .
(
1995
)
Mutation processes at human minisatellites
.
Electrophoresis
16
,
1577
1585
,
[PubMed]
7.
Laberthonniere
C.
,
Magdinier
F.
and
Robin
J.D.
(
2019
)
Bring it to an end: does telomeres size matter?
Cells
8
,
1
9
,
[PubMed]
8.
McNulty
S.M.
and
Sullivan
B.A.
(
2018
)
Alpha satellite DNA biology: finding function in the recesses of the genome
.
Chromosome Res.
26
,
115
138
,
[PubMed]
9.
Francastel
C.
,
Schubeler
D.
,
Martin
D.I.
and
Groudine
M.
(
2000
)
Nuclear compartmentalization and gene activity
.
Nat. Rev. Mol. Cell Biol.
1
,
137
143
,
[PubMed]
10.
Falk
M.
,
Feodorova
Y.
,
Naumova
N.
,
Imakaev
M.
,
Lajoie
B.R.
,
Leonhardt
H.
et al. .
(
2019
)
Heterochromatin drives compartmentalization of inverted and conventional nuclei
.
Nature
570
,
395
399
,
[PubMed]
11.
Eden
A.
,
Gaudet
F.
,
Waghmare
A.
and
Jaenisch
R.
(
2003
)
Chromosomal instability and tumors promoted by DNA hypomethylation
.
Science
300
,
455
,
[PubMed]
12.
Gaudet
F.
,
Hodgson
J.G.
,
Eden
A.
,
Jackson-Grusby
L.
,
Dausman
J.
,
Gray
J.W.
et al. .
(
2003
)
Induction of tumors in mice by genomic hypomethylation
.
Science
300
,
489
492
,
[PubMed]
13.
Chen
R.Z.
,
Pettersson
U.
,
Beard
C.
,
Jackson-Grusby
L.
and
Jaenisch
R.
(
1998
)
DNA hypomethylation leads to elevated mutation rates
.
Nature
395
,
89
93
,
[PubMed]
14.
Weissenbach
J.
(
1993
)
Microsatellite polymorphisms and the genetic linkage map of the human genome
.
Curr. Opin. Genet. Dev.
3
,
414
417
,
[PubMed]
15.
Talbert
P.B.
and
Henikoff
S.
(
2018
)
Transcribing centromeres: noncoding RNAs and kinetochore assembly
.
Trends Genet.
34
,
587
599
,
[PubMed]
16.
Bettin
N.
,
Oss Pegorar
C.
and
Cusanelli
E.
(
2019
)
The emerging roles of TERRA in telomere maintenance and genome stability
.
Cells
8
,
246
264
,
[PubMed]
17.
Biscotti
M.A.
,
Canapa
A.
,
Forconi
M.
,
Olmo
E.
and
Barucca
M.
(
2015
)
Transcription of tandemly repetitive DNA: functional roles
.
Chromosome Res.
23
,
463
477
,
[PubMed]
18.
Vourc’h
C.
and
Biamonti
G.
(
2011
)
Transcription of satellite DNAs in mammals
.
Prog. Mol. Subcell. Biol.
51
,
95
118
,
[PubMed]
19.
Jolly
C.
,
Metz
A.
,
Govin
J.
,
Vigneron
M.
,
Turner
B.M.
,
Khochbin
S.
et al. .
(
2004
)
Stress-induced transcription of satellite III repeats
.
J. Cell Biol.
164
,
25
33
,
[PubMed]
20.
Shumaker
D.K.
,
Dechat
T.
,
Kohlmaier
A.
,
Adam
S.A.
,
Bozovsky
M.R.
,
Erdos
M.R.
et al. .
(
2006
)
Mutant nuclear lamin A leads to progressive alterations of epigenetic control in premature aging
.
Proc. Natl. Acad. Sci. U.S.A.
103
,
8703
8708
,
[PubMed]
21.
Ting
D.T.
,
Lipson
D.
,
Paul
S.
,
Brannigan
B.W.
,
Akhavanfard
S.
,
Coffman
E.J.
et al. .
(
2011
)
Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers
.
Science
331
,
593
596
,
[PubMed]
22.
Fearon
E.R.
and
Vogelstein
B.
(
1990
)
A genetic model for colorectal tumorigenesis
.
Cell
61
,
759
767
,
[PubMed]
23.
Ponzetto-Zimmerman
C.
and
Wolgemuth
D.J.
(
1984
)
Methylation of satellite sequences in mouse spermatogenic and somatic DNAs
.
Nucleic Acids Res.
12
,
2807
2822
,
[PubMed]
24.
Sanford
J.
,
Forrester
L.
,
Chapman
V.
,
Chandley
A.
and
Hastie
N.
(
1984
)
Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus
.
Nucleic Acids Res.
12
,
2823
2836
,
[PubMed]
25.
Okano
M.
,
Bell
D.W.
,
Haber
D.A.
and
Li
E.
(
1999
)
DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development
.
Cell
99
,
247
257
,
[PubMed]
26.
Li
E.
and
Zhang
Y.
(
2014
)
DNA methylation in mammals
.
Cold Spring Harb. Perspect. Biol.
6
,
a019133
,
[PubMed]
27.
Schubeler
D.
(
2015
)
Function and information content of DNA methylation
.
Nature
517
,
321
326
,
[PubMed]
28.
Illingworth
R.S.
and
Bird
A.P.
(
2009
)
CpG islands–‘a rough guide’
.
FEBS Lett.
583
,
1713
1720
,
[PubMed]
29.
Weber
M.
and
Schubeler
D.
(
2007
)
Genomic patterns of DNA methylation: targets and function of an epigenetic mark
.
Curr. Opin. Cell Biol.
19
,
273
280
,
[PubMed]
30.
Weisenberger
D.J.
,
Campan
M.
,
Long
T.I.
,
Kim
M.
,
Woods
C.
,
Fiala
E.
et al. .
(
2005
)
Analysis of repetitive element DNA methylation by MethyLight
.
Nucleic Acids Res.
33
,
6823
6836
,
[PubMed]
31.
Su
J.
,
Shao
X.
,
Liu
H.
,
Liu
S.
,
Wu
Q.
and
Zhang
Y.
(
2012
)
Genome-wide dynamic changes of DNA methylation of repetitive elements in human embryonic stem cells and fetal fibroblasts
.
Genomics
99
,
10
17
,
[PubMed]
32.
Ehrlich
M.
(
2002
)
DNA methylation in cancer: too much, but also too little
.
Oncogene
21
,
5400
5413
,
[PubMed]
33.
Baubec
T.
and
Schubeler
D.
(
2014
)
Genomic patterns and context specific interpretation of DNA methylation
.
Curr. Opin. Genet. Dev.
25
,
85
92
,
[PubMed]
34.
Gacy
A.M.
,
Goellner
G.
,
Juranic
N.
,
Macura
S.
and
McMurray
C.T.
(
1995
)
Trinucleotide repeats that expand in human disease form hairpin structures in vitro
.
Cell
81
,
533
540
,
[PubMed]
35.
Kerrest
A.
,
Anand
R.P.
,
Sundararajan
R.
,
Bermejo
R.
,
Liberi
G.
,
Dujon
B.
et al. .
(
2009
)
SRS2 and SGS1 prevent chromosomal breaks and stabilize triplet repeats by restraining recombination
.
Nat. Struct. Mol. Biol.
16
,
159
167
,
[PubMed]
36.
Freudenreich
C.H.
,
Kantrow
S.M.
and
Zakian
V.A.
(
1998
)
Expansion and length-dependent fragility of CTG repeats in yeast
.
Science
279
,
853
856
,
[PubMed]
37.
Hamada
H.
,
Seidman
M.
,
Howard
B.H.
and
Gorman
C.M.
(
1984
)
Enhanced gene expression by the poly(dT-dG).poly(dC-dA) sequence
.
Mol. Cell. Biol.
4
,
2622
2630
,
[PubMed]
38.
Wang
B.
,
Ren
J.
,
Ooi
L.L.
,
Chong
S.S.
and
Lee
C.G.
(
2005
)
Dinucleotide repeats negatively modulate the promoter activity of Cyr61 and is unstable in hepatocellular carcinoma patients
.
Oncogene
24
,
3999
4008
,
[PubMed]
39.
Baranovskaya
S.
,
Martin
Y.
,
Alonso
S.
,
Pisarchuk
K.L.
,
Falchetti
M.
,
Dai
Y.
et al. .
(
2009
)
Down-regulation of epidermal growth factor receptor by selective expansion of a 5′-end regulatory dinucleotide repeat in colon cancer with microsatellite instability
.
Clin. Cancer Res.
15
,
4531
4537
,
[PubMed]
40.
Morris
E.E.
,
Amria
M.Y.
,
Kistner-Griffin
E.
,
Svenson
J.L.
,
Kamen
D.L.
,
Gilkeson
G.S.
et al. .
(
2010
)
A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis
.
Arthritis Res. Ther.
12
,
R212
,
[PubMed]
41.
Yanez-Cuna
J.O.
,
Arnold
C.D.
,
Stampfel
G.
,
Boryn
L.M.
,
Gerlach
D.
,
Rath
M.
et al. .
(
2014
)
Dissection of thousands of cell type-specific enhancers identifies dinucleotide repeat motifs as general enhancer features
.
Genome Res.
24
,
1147
1156
,
[PubMed]
42.
Bagshaw
A.T.M.
(
2017
)
Functional mechanisms of microsatellite DNA in eukaryotic genomes
.
Genome Biol. Evol.
9
,
2428
2443
,
[PubMed]
43.
Nikumbh
S.
and
Pfeifer
N.
(
2017
)
Genetic sequence-based prediction of long-range chromatin interactions suggests a potential role of short tandem repeat sequences in genome organization
.
BMC Bioinformatics
18
,
218
,
[PubMed]
44.
Tripathi
J.
and
Brahmachari
S.K.
(
1991
)
Distribution of simple repetitive (TG/CA)n and (CT/AG)n sequences in human and rodent genomes
.
J. Biomol. Struct. Dyn.
9
,
387
397
,
[PubMed]
45.
Kaartokallio
T.
,
Klemetti
M.M.
,
Timonen
A.
,
Uotila
J.
,
Heinonen
S.
,
Kajantie
E.
et al. .
(
2014
)
Microsatellite polymorphism in the heme oxygenase-1 promoter is associated with nonsevere and late-onset preeclampsia
.
Hypertension
64
,
172
177
,
[PubMed]
46.
Ayuso
P.
,
Martinez
C.
,
Pastor
P.
,
Lorenzo-Betancor
O.
,
Luengo
A.
,
Jimenez-Jimenez
F.J.
et al. .
(
2014
)
An association study between Heme oxygenase-1 genetic variants and Parkinson’s disease
.
Front. Cell Neurosci.
8
,
298
,
[PubMed]
47.
Daenen
K.E.
,
Martens
P.
and
Bammens
B.
(
2016
)
Association of HO-1 (GT)n promoter polymorphism and cardiovascular disease: a reanalysis of the literature
.
Can. J. Cardiol.
32
,
160
168
,
[PubMed]
48.
Searle
S.
and
Blackwell
J.M.
(
1999
)
Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility
.
J. Med. Genet.
36
,
295
299
,
[PubMed]
49.
Quilez
J.
,
Guilmatre
A.
,
Garg
P.
,
Highnam
G.
,
Gymrek
M.
,
Erlich
Y.
et al. .
(
2016
)
Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans
.
Nucleic Acids Res.
44
,
3750
3762
,
[PubMed]
50.
Davey
C.S.
,
Pennings
S.
,
Reilly
C.
,
Meehan
R.R.
and
Allan
J.
(
2004
)
A determining influence for CpG dinucleotides on nucleosome positioning in vitro
.
Nucleic Acids Res.
32
,
4322
4331
,
[PubMed]
51.
Snow
K.
,
Doud
L.K.
,
Hagerman
R.
,
Pergolizzi
R.G.
,
Erster
S.H.
and
Thibodeau
S.N.
(
1993
)
Analysis of a CGG sequence at the FMR-1 locus in fragile X families and in the general population
.
Am. J. Hum. Genet.
53
,
1217
1228
,
[PubMed]
52.
Wang
Y.H.
and
Griffith
J.
(
1996
)
Methylation of expanded CCG triplet repeat DNA from fragile X syndrome patients enhances nucleosome exclusion
.
J. Biol. Chem.
271
,
22937
22940
,
[PubMed]
53.
Pieretti
M.
,
Zhang
F.P.
,
Fu
Y.H.
,
Warren
S.T.
,
Oostra
B.A.
,
Caskey
C.T.
et al. .
(
1991
)
Absence of expression of the FMR-1 gene in fragile X syndrome
.
Cell
66
,
817
822
[PubMed]
54.
Coffee
B.
,
Zhang
F.
,
Warren
S.T.
and
Reines
D.
(
1999
)
Acetylated histones are associated with FMR1 in normal but not fragile X-syndrome cells
.
Nat. Genet.
22
,
98
101
,
[PubMed]
55.
Punga
T.
and
Buhler
M.
(
2010
)
Long intronic GAA repeats causing Friedreich ataxia impede transcription elongation
.
EMBO Mol. Med.
2
,
120
129
,
[PubMed]
56.
Saveliev
A.
,
Everett
C.
,
Sharpe
T.
,
Webster
Z.
and
Festenstein
R.
(
2003
)
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing
.
Nature
422
,
909
913
[PubMed]
57.
Sakamoto
N.
,
Chastain
P.D.
,
Parniewski
P.
,
Ohshima
K.
,
Pandolfo
M.
,
Griffith
J.D.
et al. .
(
1999
)
Sticky DNA: self-association properties of long GAA.TTC repeats in R.R.Y triplex structures from Friedreich’s ataxia
.
Mol. Cell.
3
,
465
475
,
[PubMed]
58.
Subramanian
S.
,
Mishra
R.K.
and
Singh
L.
(
2003
)
Genome-wide analysis of Bkm sequences (GATA repeats): predominant association with sex chromosomes and potential role in higher order chromatin organization and function
.
Bioinformatics
19
,
681
685
,
[PubMed]
59.
Sun
J.H.
,
Zhou
L.
,
Emerson
D.J.
,
Phyo
S.A.
,
Titus
K.R.
,
Gong
W.
et al. .
(
2018
)
Disease-associated short tandem repeats co-localize with chromatin domain boundaries
.
Cell
175
,
224
238.e15
,
60.
Manuelidis
L.
and
Wu
J.C.
(
1978
)
Homology between human and simian repeated DNA
.
Nature
276
,
92
94
,
[PubMed]
61.
Manuelidis
L.
(
1978
)
Chromosomal localization of complex and simple repeated human DNAs
.
Chromosoma
66
,
23
32
,
[PubMed]
62.
Willard
H.F.
(
1985
)
Chromosome-specific organization of human alpha satellite DNA
.
Am. J. Hum. Genet.
37
,
524
532
,
[PubMed]
63.
Fukagawa
T.
and
Earnshaw
W.C.
(
2014
)
The centromere: chromatin foundation for the kinetochore machinery
.
Dev. Cell
30
,
496
508
,
[PubMed]
64.
Okada
T.
,
Ohzeki
J.
,
Nakano
M.
,
Yoda
K.
,
Brinkley
W.R.
,
Larionov
V.
et al. .
(
2007
)
CENP-B controls centromere formation depending on the chromatin context
.
Cell
131
,
1287
1300
,
[PubMed]
65.
Tanaka
Y.
,
Kurumizaka
H.
and
Yokoyama
S.
(
2005
)
CpG methylation of the CENP-B box reduces human CENP-B binding
.
FEBS J.
272
,
282
289
,
[PubMed]
66.
Lee
C.
,
Wevrick
R.
,
Fisher
R.B.
,
Ferguson-Smith
M.A.
and
Lin
C.C.
(
1997
)
Human centromeric DNAs
.
Hum. Genet.
100
,
291
304
,
[PubMed]
67.
Tagarro
I.
,
Fernandez-Peralta
A.M.
and
Gonzalez-Aguilera
J.J.
(
1994
)
Chromosomal localization of human satellites 2 and 3 by a FISH method using oligonucleotides as probes
.
Hum. Genet.
93
,
383
388
,
[PubMed]
68.
Schueler
M.G.
and
Sullivan
B.A.
(
2006
)
Structural and functional dynamics of human centromeric chromatin
.
Annu. Rev. Genomics Hum. Genet.
7
,
301
313
,
[PubMed]
69.
Nishibuchi
G.
and
Dejardin
J.
(
2017
)
The molecular basis of the organization of repetitive DNA-containing constitutive heterochromatin in mammals
.
Chromosome Res.
25
,
77
87
,
[PubMed]
70.
Qu
G.Z.
,
Grundy
P.E.
,
Narayan
A.
and
Ehrlich
M.
(
1999
)
Frequent hypomethylation in Wilms tumors of pericentromeric DNA in chromosomes 1 and 16
.
Cancer Genet. Cytogenet.
109
,
34
39
,
[PubMed]
71.
Tsuda
H.
,
Takarabe
T.
,
Kanai
Y.
,
Fukutomi
T.
and
Hirohashi
S.
(
2002
)
Correlation of DNA hypomethylation at pericentromeric heterochromatin regions of chromosomes 16 and 1 with histological features and chromosomal abnormalities of human breast carcinomas
.
Am. J. Pathol.
161
,
859
866
,
[PubMed]
72.
Hall
L.L.
,
Byron
M.
,
Carone
D.M.
,
Whitfield
T.W.
,
Pouliot
G.P.
,
Fischer
A.
et al. .
(
2017
)
Demethylated HSATII DNA and HSATII RNA foci sequester PRC1 and MeCP2 into cancer-specific nuclear bodies
.
Cell Rep.
18
,
2943
2956
,
[PubMed]
73.
Ehrlich
M.
,
Jackson
K.
and
Weemaes
C.
(
2006
)
Immunodeficiency, centromeric region instability, facial anomalies syndrome (ICF)
.
Orphanet. J. Rare Dis.
1
,
2
,
[PubMed]
74.
Hagleitner
M.M.
,
Lankester
A.
,
Maraschio
P.
,
Hulten
M.
,
Fryns
J.P.
,
Schuetz
C.
et al. .
(
2008
)
Clinical spectrum of immunodeficiency, centromeric instability and facial dysmorphism (ICF syndrome)
.
J. Med. Genet.
45
,
93
99
,
[PubMed]
75.
Jeanpierre
M.
,
Turleau
C.
,
Aurias
A.
,
Prieur
M.
,
Ledeist
F.
,
Fischer
A.
et al. .
(
1993
)
An embryonic-like methylation pattern of classical satellite DNA is observed in ICF syndrome
.
Hum. Mol. Genet.
2
,
731
735
,
[PubMed]
76.
Miniou
P.
,
Jeanpierre
M.
,
Blanquet
V.
,
Sibella
V.
,
Bonneau
D.
,
Herbelin
C.
et al. .
(
1994
)
Abnormal methylation pattern in constitutive and facultative (X inactive chromosome) heterochromatin of ICF patients
.
Hum. Mol. Genet.
3
,
2093
2102
,
[PubMed]
77.
Yehezkel
S.
,
Segev
Y.
,
Viegas-Pequignot
E.
,
Skorecki
K.
and
Selig
S.
(
2008
)
Hypomethylation of subtelomeric regions in ICF syndrome is associated with abnormally short telomeres and enhanced transcription from telomeric regions
.
Hum. Mol. Genet.
17
,
2776
2789
[PubMed]
78.
Kondo
T.
,
Bobek
M.P.
,
Kuick
R.
,
Lamb
B.
,
Zhu
X.
,
Narayan
A.
et al. .
(
2000
)
Whole-genome methylation scan in ICF syndrome: hypomethylation of non-satellite DNA repeats D4Z4 and NBL2
.
Hum. Mol. Genet.
9
,
597
604
,
[PubMed]
79.
Hansen
R.S.
,
Wijmenga
C.
,
Luo
P.
,
Stanek
A.M.
,
Canfield
T.K.
,
Weemaes
C.M.
et al. .
(
1999
)
The DNMT3B DNA methyltransferase gene is mutated in the ICF immunodeficiency syndrome
.
Proc. Natl. Acad. Sci. U.S.A.
96
,
14412
14417
,
[PubMed]
80.
Xu
G.L.
,
Bestor
T.H.
,
Bourc’his
D.
,
Hsieh
C.L.
,
Tommerup
N.
,
Bugge
M.
et al. .
(
1999
)
Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene
.
Nature
402
,
187
191
,
[PubMed]
81.
Jiang
Y.L.
,
Rigolet
M.
,
Bourc’his
D.
,
Nigon
F.
,
Bokesoy
I.
,
Fryns
J.P.
et al. .
(
2005
)
DNMT3B mutations and DNA methylation defect define two types of ICF syndrome
.
Hum. Mutat.
25
,
56
63
,
[PubMed]
82.
de Greef
J.C.
,
Wang
J.
,
Balog
J.
,
den Dunnen
J.T.
,
Frants
R.R.
,
Straasheijm
K.R.
et al. .
(
2011
)
Mutations in ZBTB24 are associated with immunodeficiency, centromeric instability, and facial anomalies syndrome type 2
.
Am. J. Hum. Genet.
88
,
796
804
,
[PubMed]
83.
Thijssen
P.E.
,
Ito
Y.
,
Grillo
G.
,
Wang
J.
,
Velasco
G.
,
Nitta
H.
et al. .
(
2015
)
Mutations in CDCA7 and HELLS cause immunodeficiency-centromeric instability-facial anomalies syndrome
.
Nat. Commun.
6
,
7870
,
[PubMed]
84.
Velasco
G.
and
Francastel
C.
(
2019
)
Genetics meets DNA methylation in rare diseases
.
Clin. Genet.
95
,
210
220
,
[PubMed]
85.
Velasco
G.
,
Grillo
G.
,
Touleimat
N.
,
Ferry
L.
,
Ivkovic
I.
,
Ribierre
F.
et al. .
(
2018
)
Comparative methylome analysis of ICF patients identifies heterochromatin loci that require ZBTB24, CDCA7 and HELLS for their methylated state
.
Hum. Mol. Genet.
27
,
2409
2424
,
[PubMed]
86.
Rosic
S.
and
Erhardt
S.
(
2016
)
No longer a nuisance: long non-coding RNAs join CENP-A in epigenetic centromere regulation
.
Cell. Mol. Life Sci.
73
,
1387
1398
,
[PubMed]
87.
Bouzinba-Segard
H.
,
Guais
A.
and
Francastel
C.
(
2006
)
Accumulation of small murine minor satellite transcripts leads to impaired centromeric architecture and function
.
Proc. Natl. Acad. Sci. U.S.A.
103
,
8709
8714
,
[PubMed]
88.
Hedouin
S.
,
Grillo
G.
,
Ivkovic
I.
,
Velasco
G.
and
Francastel
C.
(
2017
)
CENP-A chromatin disassembly in stressed and senescent murine cells
.
Sci. Rep.
7
,
42520
,
[PubMed]
89.
Crossley
M.P.
,
Bocek
M.
and
Cimprich
K.A.
(
2019
)
R-Loops as cellular regulators and genomic threats
.
Mol. Cell
73
,
398
411
,
[PubMed]
90.
Giunta
S.
and
Funabiki
H.
(
2017
)
Integrity of the human centromere DNA repeats is protected by CENP-A, CENP-C, and CENP-T
.
Proc. Natl. Acad. Sci. U.S.A.
114
,
1928
1933
,
[PubMed]
91.
McNulty
S.M.
,
Sullivan
L.L.
and
Sullivan
B.A.
(
2017
)
Human centromeres produce chromosome-specific and array-specific alpha satellite transcripts that are complexed with CENP-A and CENP-C
.
Dev. Cell
42
,
226
240.e6
,
92.
Quenet
D.
and
Dalal
Y.
(
2014
)
A long non-coding RNA is required for targeting centromeric protein A to the human centromere
.
Elife
3
,
e03254
,
[PubMed]
93.
Unoki
M.
,
Funabiki
H.
,
Velasco
G.
,
Francastel
C.
and
Sasaki
H.
(
2019
)
CDCA7 and HELLS mutations undermine nonhomologous end joining in centromeric instability syndrome
.
J. Clin. Invest.
129
,
78
92
,
[PubMed]
94.
Hassan
K.M.
,
Norwood
T.
,
Gimelli
G.
,
Gartler
S.M.
and
Hansen
R.S.
(
2001
)
Satellite 2 methylation patterns in normal and ICF syndrome cells and association of hypomethylation with advanced replication
.
Hum. Genet.
109
,
452
462
,
[PubMed]
95.
Hansen
R.S.
,
Stoger
R.
,
Wijmenga
C.
,
Stanek
A.M.
,
Canfield
T.K.
,
Luo
P.
et al. .
(
2000
)
Escape from gene silencing in ICF syndrome: evidence for advanced replication time as a major determinant
.
Hum. Mol. Genet.
9
,
2575
2587
,
[PubMed]
96.
Gatto
S.
,
Gagliardi
M.
,
Franzese
M.
,
Leppert
S.
,
Papa
M.
,
Cammisa
M.
et al. .
(
2017
)
ICF-specific DNMT3B dysfunction interferes with intragenic regulation of mRNA transcription and alternative splicing
.
Nucleic Acids Res.
45
,
5739
5756
,
[PubMed]
97.
Jefferson
A.
,
Colella
S.
,
Moralli
D.
,
Wilson
N.
,
Yusuf
M.
,
Gimelli
G.
et al. .
(
2010
)
Altered intra-nuclear organisation of heterochromatin and genes in ICF syndrome
.
PLoS ONE
5
,
e11364
,
[PubMed]
98.
Nitta
H.
,
Unoki
M.
,
Ichiyanagi
K.
,
Kosho
T.
,
Shigemura
T.
,
Takahashi
H.
et al. .
(
2013
)
Three novel ZBTB24 mutations identified in Japanese and Cape Verdean type 2 ICF syndrome patients
.
J. Hum. Genet.
58
,
455
460
,
[PubMed]
99.
Rajshekar
S.
,
Yao
J.
,
Arnold
P.K.
,
Payne
S.G.
,
Zhang
Y.
,
Bowman
T.V.
et al. .
(
2018
)
Pericentromeric hypomethylation elicits an interferon response in an animal model of ICF syndrome
.
Elife
7
,
1
21
,
[PubMed]
100.
Warburton
P.E.
,
Hasson
D.
,
Guillem
F.
,
Lescale
C.
,
Jin
X.
and
Abrusan
G.
(
2008
)
Analysis of the largest tandemly repeated DNA families in the human genome
.
BMC Genomics
9
,
533
,
[PubMed]
101.
Tremblay
D.C.
,
Moseley
S.
and
Chadwick
B.P.
(
2011
)
Variation in array size, monomer composition and expression of the macrosatellite DXZ4
.
PLoS ONE
6
,
e18969
,
[PubMed]
102.
Brahmachary
M.
,
Guilmatre
A.
,
Quilez
J.
,
Hasson
D.
,
Borel
C.
,
Warburton
P.
et al. .
(
2014
)
Digital genotyping of macrosatellites and multicopy genes reveals novel biological functions associated with copy number variation of large tandem repeats
.
PLoS Genet.
10
,
e1004418
,
[PubMed]
103.
Okada
T.
,
Gondo
Y.
,
Goto
J.
,
Kanazawa
I.
,
Hadano
S.
and
Ikeda
J.E.
(
2002
)
Unstable transmission of the RS447 human megasatellite tandem repetitive sequence that contains the USP17 deubiquitinating enzyme gene
.
Hum. Genet.
110
,
302
313
,
[PubMed]
104.
Gondo
Y.
,
Okada
T.
,
Matsuyama
N.
,
Saitoh
Y.
,
Yanagisawa
Y.
and
Ikeda
J.E.
(
1998
)
Human megasatellite DNA RS447: copy-number polymorphisms and interspecies conservation
.
Genomics
54
,
39
49
,
[PubMed]
105.
Chadwick
B.P.
(
2008
)
DXZ4 chromatin adopts an opposing conformation to that of the surrounding chromosome and acquires a novel inactive X specific role involving CTCF and anti-sense transcripts
.
Genome Res.
18
,
1259
1269
[PubMed]
106.
Darrow
E.M.
,
Huntley
M.H.
,
Dudchenko
O.
,
Stamenova
E.K.
,
Durand
N.C.
,
Sun
Z.
et al. .
(
2016
)
Deletion of DXZ4 on the human inactive X chromosome alters higher-order genome architecture
.
Proc. Natl. Acad. Sci. U.S.A.
113
,
E4504
E4512
,
[PubMed]
107.
Balog
J.
,
Miller
D.
,
Sanchez-Curtailles
E.
,
Carbo-Marques
J.
,
Block
G.
,
Potman
M.
et al. .
(
2012
)
Epigenetic regulation of the X-chromosomal macrosatellite repeat encoding for the cancer/testis gene CT47
.
Eur. J. Hum. Genet.
20
,
185
191
,
[PubMed]
108.
Giacalone
J.
,
Friedes
J.
and
Francke
U.
(
1992
)
A novel GC-rich human macrosatellite VNTR in Xq24 is differentially methylated on active and inactive X chromosomes
.
Nat. Genet.
1
,
137
143
,
[PubMed]
109.
Horakova
A.H.
,
Moseley
S.C.
,
McLaughlin
C.R.
,
Tremblay
D.C.
and
Chadwick
B.P.
(
2012
)
The macrosatellite DXZ4 mediates CTCF-dependent long-range intrachromosomal interactions on the human inactive X chromosome
.
Hum. Mol. Genet.
21
,
4367
4377
,
[PubMed]
110.
Minajigi
A.
,
Froberg
J.
,
Wei
C.
,
Sunwoo
H.
,
Kesner
B.
,
Colognori
D.
et al. .
(
2015
)
Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation
.
Science
349
,
282
295
,
[PubMed]
111.
Deng
X.
,
Ma
W.
,
Ramani
V.
,
Hill
A.
,
Yang
F.
,
Ay
F.
et al. .
(
2015
)
Bipartite structure of the inactive mouse X chromosome
.
Genome Biol.
16
,
152
,
[PubMed]
112.
Rao
S.S.
,
Huntley
M.H.
,
Durand
N.C.
,
Stamenova
E.K.
,
Bochkov
I.D.
,
Robinson
J.T.
et al. .
(
2014
)
A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping
.
Cell
159
,
1665
1680
,
[PubMed]
113.
Pavelitz
T.
,
Rusche
L.
,
Matera
A.G.
,
Scharf
J.M.
and
Weiner
A.M.
(
1995
)
Concerted evolution of the tandem array encoding primate U2 snRNA occurs in situ, without changing the cytological context of the RNU2 locus
.
EMBO J.
14
,
169
177
,
[PubMed]
114.
Tessereau
C.
,
Lesecque
Y.
,
Monnet
N.
,
Buisson
M.
,
Barjhoux
L.
,
Leone
M.
et al. .
(
2014
)
Estimation of the RNU2 macrosatellite mutation rate by BRCA1 mutation tracing
.
Nucleic Acids Res.
42
,
9121
9130
,
[PubMed]
115.
Wang
L.H.
and
Tawil
R.
(
2016
)
Facioscapulohumeral dystrophy
.
Curr. Neurol. Neurosci. Rep.
16
,
66
,
[PubMed]
116.
Deenen
J.C.
,
Arnts
H.
,
van der Maarel
S.M.
,
Padberg
G.W.
,
Verschuuren
J.J.
,
Bakker
E.
et al. .
(
2014
)
Population-based incidence and prevalence of facioscapulohumeral dystrophy
.
Neurology
83
,
1056
1059
,
[PubMed]
117.
Statland
J.
and
Tawil
R.
(
2014
)
Facioscapulohumeral muscular dystrophy
.
Neurol. Clin.
32
,
721
728.ix
,
118.
Lemmers
R.J.
,
Van Overveld
P.G.
,
Sandkuijl
L.A.
,
Vrieling
H.
,
Padberg
G.W.
,
Frants
R.R.
et al. .
(
2004
)
Mechanism and timing of mitotic rearrangements in the subtelomeric D4Z4 repeat involved in facioscapulohumeral muscular dystrophy
.
Am. J. Hum. Genet.
75
,
44
53
[PubMed]
119.
Lemmers
R.J.
,
Tawil
R.
,
Petek
L.M.
,
Balog
J.
,
Block
G.J.
,
Santen
G.W.
et al. .
(
2012
)
Digenic inheritance of an SMCHD1 mutation and an FSHD-permissive D4Z4 allele causes facioscapulohumeral muscular dystrophy type 2
.
Nat. Genet.
44
,
1370
1374
,
[PubMed]
120.
Tupler
R.
,
Berardinelli
A.
,
Barbierato
L.
,
Frants
R.
,
Hewitt
J.E.
,
Lanzi
G.
et al. .
(
1996
)
Monosomy of distal 4q does not cause facioscapulohumeral muscular dystrophy
.
J. Med. Genet.
33
,
366
370
[PubMed]
121.
Hartweck
L.M.
,
Anderson
L.J.
,
Lemmers
R.J.
,
Dandapat
A.
,
Toso
E.A.
,
Dalton
J.C.
et al. .
(
2013
)
A focal domain of extreme demethylation within D4Z4 in FSHD2
.
Neurology
80
,
392
399
[PubMed]
122.
Gaillard
M.C.
,
Roche
S.
,
Dion
C.
,
Tasmadjian
A.
,
Bouget
G.
,
Salort-Campana
E.
et al. .
(
2014
)
Differential DNA methylation of the D4Z4 repeat in patients with FSHD and asymptomatic carriers
.
Neurology
83
,
733
742
[PubMed]
123.
Dion
C.
,
Roche
S.
,
Laberthonniere
C.
,
Broucqsault
N.
,
Mariot
V.
,
Xue
S.
et al. .
(
2019
)
SMCHD1 is involved in de novo methylation of the DUX4-encoding D4Z4 macrosatellite
.
Nucleic Acids Res.
47
,
2822
2839
[PubMed]
124.
Lemmers
R.J.
,
de Kievit
P.
,
Sandkuijl
L.
,
Padberg
G.W.
,
van Ommen
G.J.
,
Frants
R.R.
et al. .
(
2002
)
Facioscapulohumeral muscular dystrophy is uniquely associated with one of the two variants of the 4q subtelomere
.
Nat. Genet.
32
,
235
236
[PubMed]
125.
Lemmers
R.J.
,
van der Vliet
P.J.
,
Klooster
R.
,
Sacconi
S.
,
Camano
P.
,
Dauwerse
J.G.
et al. .
(
2010
)
A unifying genetic model for facioscapulohumeral muscular dystrophy
.
Science
329
,
1650
1653
,
[PubMed]
126.
Nguyen
K.
,
Broucqsault
N.
,
Chaix
C.
,
Roche
S.
,
Robin
J.D.
,
Vovan
C.
et al. .
(
2019
)
Deciphering the complexity of the 4q and 10q subtelomeres by molecular combing in healthy individuals and patients with facioscapulohumeral dystrophy
.
J. Med. Genet.
[PubMed]
127.
Lemmers
R.J.
,
Wohlgemuth
M.
,
van der Gaag
K.J.
,
van der Vliet
P.J.
,
van Teijlingen
C.M.
,
de Knijff
P.
et al. .
(
2007
)
Specific sequence variations within the 4q35 region are associated with facioscapulohumeral muscular dystrophy
.
Am. J. Hum. Genet.
81
,
884
894
,
[PubMed]
128.
Shaw
N.D.
,
Brand
H.
,
Kupchinsky
Z.A.
,
Bengani
H.
,
Plummer
L.
,
Jones
T.I.
et al. .
(
2017
)
SMCHD1 mutations associated with a rare muscular dystrophy can also cause isolated arhinia and Bosma arhinia microphthalmia syndrome
.
Nat. Genet.
49
,
238
248
,
[PubMed]
129.
Gordon
C.T.
,
Xue
S.
,
Yigit
G.
,
Filali
H.
,
Chen
K.
,
Rosin
N.
et al. .
(
2017
)
De novo mutations in SMCHD1 cause Bosma arhinia microphthalmia syndrome and abrogate nasal development
.
Nat. Genet.
49
,
249
255
,
[PubMed]
130.
van den Boogaard
M.L.
,
Lemmers
R.J.
,
Balog
J.
,
Wohlgemuth
M.
,
Auranen
M.
,
Mitsuhashi
S.
et al. .
(
2016
)
Mutations in DNMT3B modify epigenetic repression of the D4Z4 repeat and the penetrance of facioscapulohumeral dystrophy
.
Am. J. Hum. Genet.
98
,
1020
1029
,
[PubMed]
131.
Lemmers
R.J.
,
van den Boogaard
M.L.
,
van der Vliet
P.J.
,
Donlin-Smith
C.M.
,
Nations
S.P.
,
Ruivenkamp
C.A.
et al. .
(
2015
)
Hemizygosity for SMCHD1 in facioscapulohumeral muscular dystrophy type 2: consequences for 18p deletion syndrome
.
Hum. Mutat.
36
,
679
683
,
[PubMed]
132.
Jones
T.I.
,
Chen
J.C.
,
Rahimov
F.
,
Homma
S.
,
Arashiro
P.
,
Beermann
M.L.
et al. .
(
2012
)
Facioscapulohumeral muscular dystrophy family studies of DUX4 expression: evidence for disease modifiers and a quantitative model of pathogenesis
.
Hum. Mol. Genet.
21
,
4419
4430
,
[PubMed]
133.
Broucqsault
N.
,
Morere
J.
,
Gaillard
M.C.
,
Dumonceaux
J.
,
Torrents
J.
,
Salort-Campana
E.
et al. .
(
2013
)
Dysregulation of 4q35- and muscle-specific genes in fetuses with a short D4Z4 array linked to facio-scapulo-humeral dystrophy
.
Hum. Mol. Genet.
22
,
4206
4214
,
[PubMed]
134.
Jiang
C.
and
Liao
D.
(
1999
)
Striking bimodal methylation of the repeat unit of the tandem array encoding human U2 snRNA (the RNU2 locus)
.
Genomics
62
,
508
518
,
[PubMed]
135.
Ottaviani
A.
,
Schluth-Bolard
C.
,
Gilson
E.
and
Magdinier
F.
(
2010
)
D4Z4 as a prototype of CTCF and lamins-dependent insulator in human cells
.
Nucleus
1
,
30
36
,
[PubMed]
136.
Ottaviani
A.
,
Rival-Gervier
S.
,
Boussouar
A.
,
Foerster
A.M.
,
Rondier
D.
,
Sacconi
S.
et al. .
(
2009
)
The D4Z4 macrosatellite repeat acts as a CTCF and A-type lamins-dependent insulator in facio-scapulo-humeral dystrophy
.
PLoS Genet.
5
,
e1000394
,
[PubMed]
137.
Robin
J.D.
,
Ludlow
A.T.
,
Batten
K.
,
Gaillard
M.C.
,
Stadler
G.
,
Magdinier
F.
et al. .
(
2015
)
SORBS2 transcription is activated by telomere position effect-over long distance upon telomere shortening in muscle cells from patients with facioscapulohumeral dystrophy
.
Genome Res.
25
,
1781
1790
,
[PubMed]
138.
Cortesi
A.
,
Pesant
M.
,
Sinha
S.
,
Marasca
F.
,
Sala
E.
,
Gregoretti
F.
et al. .
(
2019
)
4q-D4Z4 chromatin architecture regulates the transcription of muscle atrophic genes in facioscapulohumeral muscular dystrophy
.
Genome Res.
29
,
883
895
,
[PubMed]
139.
Hendrickson
P.G.
,
Dorais
J.A.
,
Grow
E.J.
,
Whiddon
J.L.
,
Lim
J.W.
,
Wike
C.L.
et al. .
(
2017
)
Conserved roles of mouse DUX and human DUX4 in activating cleavage-stage genes and MERVL/HERVL retrotransposons
.
Nat. Genet.
49
,
925
934
,
[PubMed]
140.
De Iaco
A.
,
Planet
E.
,
Coluccio
A.
,
Verp
S.
,
Duc
J.
and
Trono
D.
(
2017
)
DUX-family transcription factors regulate zygotic genome activation in placental mammals
.
Nat. Genet.
49
,
941
945
,
[PubMed]
141.
Block
G.J.
,
Petek
L.M.
,
Narayanan
D.
,
Amell
A.M.
,
Moore
J.M.
,
Rabaia
N.A.
et al. .
(
2012
)
Asymmetric bidirectional transcription from the FSHD-causing D4Z4 array modulates DUX4 production
.
PLoS ONE
7
,
e35532
,
[PubMed]
142.
Cabianca
D.S.
,
Casa
V.
,
Bodega
B.
,
Xynos
A.
,
Ginelli
E.
,
Tanaka
Y.
et al. .
(
2012
)
A long ncRNA links copy number variation to a polycomb/trithorax epigenetic switch in FSHD muscular dystrophy
.
Cell
149
,
819
831
,
[PubMed]
143.
Dumbovic
G.
,
Forcales
S.V.
and
Perucho
M.
(
2017
)
Emerging roles of macrosatellite repeats in genome organization and disease development
.
Epigenetics
12
,
515
526
,
[PubMed]
144.
Arnoult
N.
,
Schluth-Bolard
C.
,
Letessier
A.
,
Drascovic
I.
,
Bouarich-Bourimi
R.
,
Campisi
J.
et al. .
(
2010
)
Replication timing of human telomeres is chromosome arm-specific, influenced by subtelomeric structures and connected to nuclear localization
.
PLoS Genet.
6
,
e1000920
,
[PubMed]
145.
Gdula
M.R.
,
Nesterova
T.B.
,
Pintacuda
G.
,
Godwin
J.
,
Zhan
Y.
,
Ozadam
H.
et al. .
(
2019
)
The non-canonical SMC protein SmcHD1 antagonises TAD formation and compartmentalisation on the inactive X chromosome
.
Nat. Commun.
10
,
30
,
[PubMed]
146.
Wang
C.Y.
,
Jegu
T.
,
Chu
H.P.
,
Oh
H.J.
and
Lee
J.T.
(
2018
)
SMCHD1 merges chromosome compartments and assists formation of super-structures on the inactive X
.
Cell
174
,
406
421.e25
,
147.
Jansz
N.
,
Keniry
A.
,
Trussart
M.
,
Bildsoe
H.
,
Beck
T.
,
Tonks
I.D.
et al. .
(
2018
)
Smchd1 regulates long-range chromatin interactions on the inactive X chromosome and at Hox clusters
.
Nat. Struct. Mol. Biol.
25
,
766
777
,
[PubMed]
148.
Perry
G.H.
,
Dominy
N.J.
,
Claw
K.G.
,
Lee
A.S.
,
Fiegler
H.
,
Redon
R.
et al. .
(
2007
)
Diet and the evolution of human amylase gene copy number variation
.
Nat. Genet.
39
,
1256
1260
,
[PubMed]
149.
Sullivan
L.L.
,
Maloney
K.A.
,
Towers
A.J.
,
Gregory
S.G.
and
Sullivan
B.A.
(
2016
)
Human centromere repositioning within euchromatin after partial chromosome deletion
.
Chromosome Res.
24
,
451
466
,
[PubMed]
150.
Bensimon
A.
,
Simon
A.
,
Chiffaudel
A.
,
Croquette
V.
,
Heslot
F.
and
Bensimon
D.
(
1994
)
Alignment and sensitive detection of DNA by a moving interface
.
Science
265
,
2096
2098
,
[PubMed]
151.
Nguyen
K.
,
Walrafen
P.
,
Bernard
R.
,
Attarian
S.
,
Chaix
C.
,
Vovan
C.
et al. .
(
2011
)
Molecular combing reveals allelic combinations in facioscapulohumeral dystrophy
.
Ann. Neurol.
70
,
627
633
,
[PubMed]
152.
Michalet
X.
,
Ekong
R.
,
Fougerousse
F.
,
Rousseaux
S.
,
Schurra
C.
,
Hornigold
N.
et al. .
(
1997
)
Dynamic molecular combing: stretching the whole human genome for high-resolution studies
.
Science
277
,
1518
1523
,
[PubMed]